ID: 1025798551

View in Genome Browser
Species Human (GRCh38)
Location 7:64762341-64762363
Sequence CAGCCTACTCACCTCAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025798547_1025798551 -9 Left 1025798547 7:64762327-64762349 CCCTGCAGGTGTCCCAGCCTACT No data
Right 1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG No data
1025798548_1025798551 -10 Left 1025798548 7:64762328-64762350 CCTGCAGGTGTCCCAGCCTACTC No data
Right 1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG No data
1025798546_1025798551 -8 Left 1025798546 7:64762326-64762348 CCCCTGCAGGTGTCCCAGCCTAC No data
Right 1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG No data
1025798543_1025798551 23 Left 1025798543 7:64762295-64762317 CCAAGTTGGTTGGTCTTTTACTG No data
Right 1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025798551 Original CRISPR CAGCCTACTCACCTCAGCCA TGG Intergenic
No off target data available for this crispr