ID: 1025803137

View in Genome Browser
Species Human (GRCh38)
Location 7:64806483-64806505
Sequence AGGTGTCATCTGTACATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025803137 Original CRISPR AGGTGTCATCTGTACATTGT GGG (reversed) Intronic
901164930 1:7213223-7213245 TGGGGTCATCCGTACATTGCTGG - Intronic
906481851 1:46204285-46204307 GGATCTCATCTGTACATTCTTGG + Intronic
909127736 1:71695943-71695965 AGGTGACAACTGTACATAGTGGG - Intronic
910728439 1:90363180-90363202 AGGTGCCATCTATGCAATGTTGG - Intergenic
911804356 1:102186708-102186730 AGTTGTCATCTATTCATTGGTGG - Intergenic
911841444 1:102687099-102687121 AGGTGTCAGTTGTAAATAGTGGG - Intergenic
913965252 1:143371570-143371592 AGTTGTCATCAGTTCATTGGTGG - Intergenic
914059628 1:144197172-144197194 AGTTGTCATCAGTTCATTGGTGG - Intergenic
914119522 1:144769199-144769221 AGTTGTCATCAGTTCATTGGTGG + Intergenic
914904585 1:151733440-151733462 AGGTGTCCTCTTTACATTTCAGG + Intergenic
918639328 1:186819994-186820016 AGGCCTCATTTGTACAATGTAGG + Intergenic
919374597 1:196778255-196778277 AAGTGACATCTTTACTTTGTGGG - Intronic
921354396 1:214272808-214272830 AAGTCTTATCTGTACCTTGTTGG - Intergenic
922768256 1:228167042-228167064 AGTTGTGATGTGAACATTGTCGG - Intronic
923384686 1:233454529-233454551 AGGTTCCATCTGTACATAGGAGG - Intergenic
1063798232 10:9538087-9538109 AGGTGACATCAGTCCAATGTTGG + Intergenic
1066109651 10:32184620-32184642 AGGTGTCACCCGTAAGTTGTGGG + Intergenic
1067715599 10:48688646-48688668 AGGTGTCATGTGAAGATTGTAGG + Intronic
1070461169 10:76671931-76671953 AGGTGTGATGTTTACATAGTAGG + Intergenic
1071771809 10:88737521-88737543 AGGTGACATCTGCTCAGTGTTGG - Intronic
1073523570 10:104157572-104157594 AGGTATTTTATGTACATTGTAGG + Intronic
1079502449 11:21116631-21116653 AGGAGTTATCTCTACATTTTTGG - Intronic
1080955650 11:37091955-37091977 AGGACTCATCTCTACATTGAGGG + Intergenic
1083850579 11:65364037-65364059 AGGTGCCATCTGAACATAGAGGG - Intergenic
1084954137 11:72682614-72682636 TGTTGTCATCTGTACTTTGCGGG - Intergenic
1086756647 11:90572271-90572293 AGGTCTCATTTGTCCATTTTTGG + Intergenic
1087672196 11:101120970-101120992 TGGTGTCATCTGTTCATATTTGG - Intronic
1088897471 11:114089264-114089286 ATGTCTCATTTGTACATTATAGG + Intronic
1089347864 11:117802724-117802746 AGTTGTCATCTTGACCTTGTAGG + Intronic
1090708564 11:129363621-129363643 AGGTGTCATCTATAAATTCAGGG + Intergenic
1091288608 11:134423764-134423786 AGGTTTCATATGTAAATAGTAGG + Intergenic
1091340103 11:134804693-134804715 GGGGATCATCTGTATATTGTAGG + Intergenic
1097502342 12:60420179-60420201 GGGTCTTATCTGAACATTGTGGG - Intergenic
1098152728 12:67564407-67564429 AGGTGTTGTGTGTACATGGTGGG + Intergenic
1098962305 12:76751576-76751598 AGTTGTCATCTGTAAAATGAAGG - Intergenic
1099411065 12:82328868-82328890 AGGTTTGTTCTGTACATTTTAGG + Intronic
1100362871 12:93894332-93894354 AGGGGCCATCTGAGCATTGTAGG - Intronic
1104533434 12:129594796-129594818 ATGTGGCCTCTGTACATAGTAGG + Intronic
1105230510 13:18490880-18490902 AGGTGTTAACTGCACATTTTTGG + Intergenic
1111728078 13:92038268-92038290 AGTTTTCATTTGTACATTGAGGG + Intronic
1116817144 14:49594858-49594880 AGCTGTCATCAGTTCATTGGTGG - Intronic
1118427815 14:65686132-65686154 AGGTGTCTTCTCCACATGGTAGG - Intronic
1119993173 14:79222636-79222658 AAGTCTCATCTATAGATTGTGGG - Intronic
1122535919 14:102462827-102462849 AGGAGTTCTCTGCACATTGTAGG - Intronic
1123687827 15:22812008-22812030 GGGTGTCATCTGCACATTTAAGG - Intronic
1128183296 15:65623740-65623762 AGGGGTCCTCTGTACTATGTAGG - Intronic
1129281754 15:74490409-74490431 AGGAGTCATCTGTGCATTCCAGG - Intergenic
1131348099 15:91670162-91670184 TGGTGTCATCTACACATTGATGG - Intergenic
1131732627 15:95297888-95297910 AGGTACCATCTGTGCATTGTAGG - Intergenic
1136747743 16:32606819-32606841 AGGGGTCATCTTTAAATGGTAGG + Intergenic
1140376283 16:74447875-74447897 AGATGTCAACTCTACATTGGAGG + Intergenic
1203049878 16_KI270728v1_random:866028-866050 AGGGGTCATCTTTAAATGGTAGG + Intergenic
1144430710 17:15189098-15189120 AGTTGTCATCTGTCCTTTTTGGG - Intergenic
1145159438 17:20564682-20564704 AGATCTCATCTGTGCACTGTGGG - Intergenic
1148227541 17:45909347-45909369 AAGTGTTCTCTGCACATTGTGGG - Intronic
1150507480 17:65714270-65714292 ATGTTACATCTTTACATTGTGGG - Intronic
1150716920 17:67580028-67580050 AGAAGTCATCTCTAAATTGTGGG - Intronic
1151046435 17:70925193-70925215 AAATGTCATCTTTACATTATCGG + Intergenic
1155072205 18:22326495-22326517 AGGTGCCTTATGTACATTATTGG + Intergenic
1155216036 18:23643707-23643729 AGGTGTCATCAGCCAATTGTGGG + Intronic
1158065900 18:53408081-53408103 ATGTGGGATCTGTACATTTTTGG - Intronic
1159614034 18:70559588-70559610 TGGTGTCCTCTGTACTGTGTAGG + Intergenic
1159809834 18:73004506-73004528 AGCTGTCCTCTATGCATTGTAGG + Intergenic
1164179230 19:22805654-22805676 GGTTGCCATCTGTACCTTGTGGG - Intergenic
1167446552 19:49541306-49541328 AGGTGTCATCTATATAATGGAGG - Intronic
1202699030 1_KI270712v1_random:149058-149080 AGTTGTCATCAGTTCATTGGTGG - Intergenic
933369650 2:81398659-81398681 AGGTGTGACCTTTACATAGTGGG - Intergenic
934169981 2:89532539-89532561 AGTTGTCATCAGTTCATTGGTGG - Intergenic
934280283 2:91606847-91606869 AGTTGTCATCAGTTCATTGGTGG - Intergenic
941284315 2:163590537-163590559 AGGTCTGAACTCTACATTGTAGG - Intergenic
945040065 2:205736481-205736503 AGTTGTCATCTGAAAATTGTTGG + Intronic
947334034 2:229062182-229062204 AGGTTTCATCTTTTCACTGTGGG + Intronic
1170504710 20:17013151-17013173 AGCTGTCCTGTGTGCATTGTAGG - Intergenic
1170528105 20:17261209-17261231 AGTTGTTCTCTGTACATTGAAGG + Intronic
1174666456 20:52262523-52262545 AGGTGGCATCTGTCCTTGGTAGG - Intergenic
1177224847 21:18241166-18241188 AGGTGTCATCTCTAAAATATTGG + Intronic
1178794281 21:35729376-35729398 AAGTGTTATAAGTACATTGTTGG + Intronic
951282916 3:20774720-20774742 GGGGGTGTTCTGTACATTGTAGG - Intergenic
952823882 3:37508783-37508805 ATGTGTAATCTGTACATTCATGG + Intronic
955405165 3:58621271-58621293 AGGTGACATCTGTGCATGGGAGG - Intronic
956331845 3:68118988-68119010 TTGTGTCATTTGTACACTGTTGG - Intronic
956694365 3:71906192-71906214 AGTCCTCATCTGTACATTATAGG + Intergenic
956937152 3:74116003-74116025 AGGTGTCATCTTTACATGGTTGG + Intergenic
957173969 3:76780012-76780034 AGGAATCCTCTGTACACTGTTGG - Intronic
957184632 3:76925785-76925807 AGTTGTCATCTGATCATAGTAGG + Intronic
960630934 3:119729694-119729716 AACAGTCATCTGTGCATTGTTGG + Intronic
962875522 3:139533354-139533376 AAGTGTCAACAGTACTTTGTTGG + Intronic
964004363 3:151810935-151810957 AGGAGTCATCTATAAATAGTTGG - Intergenic
965126025 3:164630541-164630563 AGTGTTCATCTATACATTGTTGG + Intergenic
965152925 3:165005470-165005492 AAGTGTCATGTGCACATAGTAGG - Intronic
965668957 3:171126662-171126684 AGGTGTTATCTGTGCAATCTAGG - Intronic
966304295 3:178513476-178513498 AGGTGTCGTCTCCACTTTGTTGG - Intronic
966603060 3:181794599-181794621 AGGAGCCATCTGTACTTTGAGGG + Intergenic
966878231 3:184335689-184335711 AGGTGTCATCTGTAAAATGAAGG + Intronic
967773678 3:193362298-193362320 AGTTATCATCAGTGCATTGTTGG - Intronic
969030477 4:4208992-4209014 AGTTGTCATCAGTTCATTGGTGG + Intronic
969547659 4:7842271-7842293 AGGTTTCATCTTTGAATTGTGGG - Intronic
972937408 4:44154991-44155013 AGTGTTCATCTGTACATTATCGG - Intergenic
976383024 4:84421742-84421764 AAGTGTCATCAGAACATTTTAGG - Intergenic
977766927 4:100809716-100809738 AGTTTTGATCTGTACATTCTGGG - Intronic
978258814 4:106726158-106726180 AGGGATCATTTGTACATTGCTGG + Intergenic
978571654 4:110144540-110144562 AGGAGTCATCTGTACTCTGATGG - Intronic
978876631 4:113647546-113647568 AGGGCTCTTCTGTGCATTGTAGG + Intronic
978996079 4:115154970-115154992 AGATGCCATCTGTTCATTCTAGG + Intergenic
980948452 4:139347180-139347202 AGATCTCTTCTGTGCATTGTAGG + Intronic
985055676 4:186033888-186033910 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055684 4:186033933-186033955 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055692 4:186033978-186034000 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055700 4:186034023-186034045 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055708 4:186034068-186034090 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055716 4:186034113-186034135 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055724 4:186034158-186034180 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055731 4:186034203-186034225 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055742 4:186034293-186034315 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055763 4:186034428-186034450 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055786 4:186034563-186034585 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055810 4:186034698-186034720 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055857 4:186034968-186034990 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055878 4:186035103-186035125 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055886 4:186035147-186035169 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055905 4:186035282-186035304 AGGTGTGATCTGTACCCTGAGGG - Intergenic
985055910 4:186035327-186035349 AGGTGTGATCTGTACACTGAGGG - Intergenic
985238654 4:187905274-187905296 AACTGTAATCTATACATTGTGGG + Intergenic
985560468 5:583610-583632 AGGGGTCAAATGTACATTCTGGG + Intergenic
986818894 5:11444224-11444246 TGGTGTCATCGGATCATTGTTGG + Intronic
988726178 5:33928645-33928667 AGGTGATATCTCTTCATTGTTGG - Intergenic
990944665 5:61237341-61237363 AGTTGTCCTCTGGGCATTGTGGG + Intergenic
997307938 5:132853689-132853711 AAGTGTCAACTGTACATTTTGGG - Intergenic
1001989269 5:176102736-176102758 AGGGGTCATCTTTAAATGGTAGG + Intronic
1001989945 5:176108056-176108078 AGGGGTCATCTTTAAATGGTAGG + Intronic
1002226926 5:177730082-177730104 AGGGGTCATCTTTAAATGGTAGG - Intronic
1002227601 5:177735402-177735424 AGGGGTCATCTTTAAATGGTAGG - Intronic
1004142195 6:13028638-13028660 AGGTGCGTCCTGTACATTGTAGG + Intronic
1004900286 6:20187300-20187322 AGGTCTCATCTGTAAAGTGAGGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1011698150 6:89931646-89931668 TGGTGTCATTTGAGCATTGTAGG - Exonic
1011772203 6:90686436-90686458 AAGTCTCATCTGTCCATTTTTGG - Intergenic
1012704620 6:102505966-102505988 ATGTGTCATCTGATCTTTGTTGG - Intergenic
1013347915 6:109279968-109279990 ATTTGTCATCTGTACATCTTTGG - Intergenic
1014494859 6:122108601-122108623 TAGTGTCATCAGCACATTGTTGG + Intergenic
1015594708 6:134855496-134855518 GGGGCTCTTCTGTACATTGTAGG + Intergenic
1017628388 6:156371235-156371257 TTGTGTCATCTGTGGATTGTTGG + Intergenic
1017734231 6:157346391-157346413 TGGTGTCATCTGTACAGCATTGG - Intergenic
1018496015 6:164346542-164346564 AGCTGTCATCTGTAAATTCATGG + Intergenic
1019916045 7:4133358-4133380 AGGTGTCGTATGTACAGTGGGGG + Intronic
1021106419 7:16644855-16644877 AGGTCTCATCTGTGCAACGTGGG + Intronic
1021123972 7:16828919-16828941 AGGTGACATGTGTTCTTTGTAGG - Intronic
1022417593 7:30191313-30191335 AGATGCCATCTGTACAATGGAGG + Intergenic
1024611679 7:51070213-51070235 AGGAGTTATCTGTATATTTTTGG - Intronic
1025803137 7:64806483-64806505 AGGTGTCATCTGTACATTGTGGG - Intronic
1027928894 7:84505492-84505514 AGGGGTCACCTTTACATTGAGGG + Intergenic
1031159171 7:118145282-118145304 TGGTGTCATTGGGACATTGTAGG + Intergenic
1031159309 7:118146775-118146797 TGGTGTCATGGGGACATTGTAGG + Intergenic
1031267822 7:119604215-119604237 AGGTTTCACTTGTACATTTTGGG - Intergenic
1032804289 7:135339758-135339780 ACTTGTCATCTATACATTGGCGG + Intergenic
1037172004 8:15904394-15904416 AAATGTCATCTGTTCATTGAGGG + Intergenic
1040506027 8:48048773-48048795 AGGTGAGATCTGTAGATGGTTGG + Intronic
1041024771 8:53672707-53672729 AGGTGTGAACTCTAGATTGTTGG + Intergenic
1042498981 8:69488712-69488734 GGCTGTCATCTGTCCACTGTTGG - Intronic
1043754578 8:83986816-83986838 AGGCGACCCCTGTACATTGTTGG + Intergenic
1044163740 8:88954116-88954138 AGGGGACACTTGTACATTGTTGG + Intergenic
1050290846 9:4153012-4153034 AGGAGTGCTCTGTGCATTGTAGG + Intronic
1055289503 9:74768349-74768371 AGGAGTCATCTGCCTATTGTAGG - Intronic
1058430076 9:104910496-104910518 AGTTGCTATCTGTACATTTTGGG - Intronic
1059007226 9:110416856-110416878 AGGACTGTTCTGTACATTGTAGG + Intronic
1059614704 9:115936547-115936569 AGAGGTCCTCTGCACATTGTTGG + Intergenic
1186204298 X:7185238-7185260 ATGTGTGATCTGTTCATTGTTGG - Intergenic
1186831419 X:13394128-13394150 AGTTGGCATCTGTAGATTGCAGG + Intergenic
1187328358 X:18313023-18313045 ATGTGTATTCTGTGCATTGTAGG + Intronic
1188174653 X:26974659-26974681 AGGTGTCATCTGGGGACTGTAGG - Intergenic
1188436559 X:30166809-30166831 AGGGAACATCTGTACACTGTTGG - Intergenic
1188779103 X:34258249-34258271 AGGGGCCGTCTATACATTGTGGG + Intergenic
1190273291 X:48883807-48883829 TGGTTTCAGCTGTACTTTGTAGG - Intergenic
1192709517 X:73565107-73565129 AGTTGGCATCTGAATATTGTAGG - Intronic
1196542934 X:116930825-116930847 AGGTGTCAGCTGGGCATCGTGGG - Intergenic
1197567379 X:128103859-128103881 AGGTACCATTTATACATTGTTGG + Intergenic
1198393663 X:136201745-136201767 AGCCCTCATCTGTACATAGTAGG - Intronic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic