ID: 1025806019

View in Genome Browser
Species Human (GRCh38)
Location 7:64835517-64835539
Sequence ACCAGGGTGGAGAGGGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025806010_1025806019 2 Left 1025806010 7:64835492-64835514 CCACAGGTGAAAACCACCAAGAA 0: 1
1: 0
2: 8
3: 43
4: 460
Right 1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG 0: 1
1: 0
2: 2
3: 24
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025806019 Original CRISPR ACCAGGGTGGAGAGGGTCCT AGG Intergenic
900160199 1:1219695-1219717 CCCAGGGTGGCTTGGGTCCTTGG - Intronic
900293815 1:1938676-1938698 ACCTGGGTGCAGAGAGGCCTGGG - Intronic
900953885 1:5875115-5875137 ACATGGGTGGACAGGGTCCCAGG + Intronic
901428357 1:9197793-9197815 ACCAGGGTGGAGGGTCTCCCAGG + Intergenic
901637605 1:10677564-10677586 ATCAGGGTGGAGGCTGTCCTAGG + Intronic
901684285 1:10935060-10935082 TCCAGGCTCCAGAGGGTCCTGGG + Intergenic
902058534 1:13622243-13622265 ACCGGGGTTGAGCAGGTCCTAGG - Intergenic
902375350 1:16027726-16027748 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902380314 1:16049523-16049545 CCCAGGGTGGAGGGGGTGCCAGG - Intronic
902643080 1:17779181-17779203 TCCAGGAGGGAGAGGGTCCATGG - Intronic
903328087 1:22582737-22582759 ACCAGGGTGCGGGGGGTGCTGGG - Intronic
903653400 1:24934428-24934450 AGCAGGGTGGTGAGGGTGTTAGG + Intronic
903944343 1:26952219-26952241 CCCATGGTGGCCAGGGTCCTTGG + Exonic
905435873 1:37954760-37954782 ATGAGGGTGGAGAGGGTCACAGG + Intergenic
905733107 1:40309974-40309996 GCCAGGGTGAGGAAGGTCCTAGG - Exonic
905880100 1:41457648-41457670 CCCAGGGAGGAGAGGGAGCTGGG + Intergenic
906181576 1:43824735-43824757 ACCACCGTGCAGAGAGTCCTCGG - Exonic
906294710 1:44642494-44642516 ACCAGGAGGGAGAAGGTTCTAGG + Intronic
907240484 1:53078360-53078382 TCCAGGCTGGAGAGCTTCCTGGG - Exonic
907487473 1:54787709-54787731 ACCTCGGTGGCGGGGGTCCTCGG + Exonic
907951326 1:59186758-59186780 ACCAGGGTGGGGAGGTCACTGGG - Intergenic
908511610 1:64854196-64854218 ACCAGGATAGAAAGGGACCTGGG - Intronic
908957895 1:69657487-69657509 ACCTGGATGAAGAGGATCCTTGG - Intronic
909864581 1:80651589-80651611 ACCACACTGGAGAGGGTACTGGG - Intergenic
910509759 1:87990651-87990673 ACCAGTGGGGAGAAGGTCATGGG - Intergenic
911236921 1:95421905-95421927 AGCAGGGTGGAGAGTGGCTTTGG + Intergenic
912570975 1:110620645-110620667 TGCAGGGTGGAGAGAGTGCTAGG + Intronic
912679577 1:111720555-111720577 AACAGCTTGGAGAGGGTGCTGGG + Intronic
913075601 1:115338386-115338408 GCCCGGCTGGAGGGGGTCCTGGG + Intergenic
913128953 1:115820420-115820442 AACAGAGTGGAGCGGGTCATGGG + Intergenic
915990716 1:160512700-160512722 ACCAGGGTGGGGAGGGACCCAGG + Intronic
917001966 1:170370263-170370285 CCCGGGGTGGGGTGGGTCCTGGG - Intergenic
917926007 1:179789616-179789638 AGAAGGGTGGAGAATGTCCTGGG + Intronic
1063130361 10:3172657-3172679 ACCCGGGAGGGGAGGGTCCAGGG - Intronic
1067713778 10:48671592-48671614 TCCACGGTGGAGAGGAGCCTTGG - Intergenic
1067719302 10:48715085-48715107 ACCTGTGTGGAGAGGATCCAAGG + Intronic
1068933382 10:62613587-62613609 AGCAGGGAGGAGAGATTCCTCGG - Intronic
1069676720 10:70254008-70254030 AGCAGGGAGGAGAGAGACCTTGG + Exonic
1072053030 10:91725276-91725298 ACCAGGGTGGAGAGGCAGCAAGG - Intergenic
1074266966 10:111914469-111914491 AACACGGGGGAGAGGGGCCTGGG - Intergenic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1075794545 10:125109764-125109786 TAAAGGGTGGGGAGGGTCCTGGG + Intronic
1076424976 10:130361389-130361411 ACCAGCCTGGAGGGGGTCCCTGG + Intergenic
1077215476 11:1393647-1393669 GCCAGGGTGGAGAGGGGTCCTGG + Intronic
1077837510 11:5937628-5937650 ACCAGGGCGGAGAGGGTCGTAGG - Intronic
1078843754 11:15103405-15103427 AGGATGGTGGAGAGGGTGCTGGG - Intergenic
1079056081 11:17207777-17207799 GCAAGGGTGGAGAGGGGCCCCGG - Intronic
1079762326 11:24344505-24344527 ACCAGGTGGGAGGGGGTCCCTGG - Intergenic
1082821994 11:57550306-57550328 CCCAGAGTGCAGAGGTTCCTGGG - Intergenic
1082843021 11:57704717-57704739 ACCTGGGGGGACAGGATCCTGGG + Exonic
1083629501 11:64088343-64088365 ACCAGGGGGCAGTGGGGCCTTGG + Intronic
1083936757 11:65873377-65873399 ACCCGGCTGAAGACGGTCCTGGG - Intronic
1084714653 11:70865977-70865999 ACCAGGGAGGAGAGGGCCCAGGG - Intronic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1087290669 11:96316959-96316981 ACCAGAGTGGGGAGGGGGCTTGG - Intronic
1089148980 11:116350293-116350315 ACTAGGGTTGAGATGCTCCTGGG + Intergenic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1089348742 11:117809237-117809259 TCCAGGGTGGGGCAGGTCCTGGG + Intronic
1089755119 11:120680860-120680882 TACAGGGAGAAGAGGGTCCTTGG - Intronic
1090944504 11:131417906-131417928 TCCATGGTGGAAAGTGTCCTGGG + Intronic
1091112982 11:132987795-132987817 ACCAGGGTGAAGGGAGGCCTTGG - Intronic
1091319424 11:134639448-134639470 CCCAGTTTGGAGAGGGTACTGGG + Intergenic
1093744588 12:22725596-22725618 AAGAGCGTGGAGAGAGTCCTGGG + Intergenic
1101001502 12:100362243-100362265 ACCATGGTGGCAAGGGTCATGGG + Intronic
1102957147 12:117066137-117066159 CCTAGGGAGGAGAGGGTCCTTGG - Intronic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1103793903 12:123490355-123490377 ACCTGGGTGGGAAGGGCCCTTGG - Intronic
1104576760 12:129973045-129973067 ACCGGGGTGGACAGGAGCCTAGG - Intergenic
1105438396 13:20396395-20396417 AGAAGGCTGGAGAGGGACCTGGG - Intergenic
1108431916 13:50361894-50361916 GGCAGGGTGGTGAGGGTCCAGGG - Intronic
1109388728 13:61666723-61666745 ACCAGGTGGGAGGGGGTCCCTGG - Intergenic
1112734325 13:102400373-102400395 TTCAGGGTGGAGAGGGACCCGGG - Intronic
1114294572 14:21317416-21317438 ATCATGGTGGAGAAGTTCCTTGG + Intronic
1116484230 14:45427651-45427673 ACCAGGGAAAAGAGGGACCTGGG + Intergenic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1119319484 14:73721240-73721262 AGCAGGGTGGAGCTGGGCCTGGG - Intronic
1120925804 14:89796135-89796157 AACAGGGTGATGAGGGTACTGGG - Exonic
1121345920 14:93135905-93135927 GCCATGGTGGAGAGAGTGCTGGG - Intergenic
1121600639 14:95200456-95200478 GCCAGGGAGGAGAAGGGCCTGGG - Intronic
1121780180 14:96617255-96617277 ACCAGGGTGGGGAGGGGCTGAGG + Intergenic
1121866094 14:97364124-97364146 CCCAAGGTGGGGAGGGCCCTAGG + Intergenic
1122372253 14:101235315-101235337 CCCAGGGTGGTGAGGGGCCCTGG - Intergenic
1123059175 14:105586744-105586766 ACCAGGGTGGAAAGTCTCATGGG + Intergenic
1123076505 14:105669893-105669915 CCCAGGGTGCAGAGGCCCCTCGG + Intergenic
1123083506 14:105706975-105706997 ACCAGGGTGGAAAGGCTCAGGGG + Intergenic
1126308277 15:47286252-47286274 CCCAGTGTGCAGAGGGTCTTAGG + Intronic
1127546031 15:59995106-59995128 CGCAGGGAGGAGAGGGCCCTGGG - Intergenic
1128242412 15:66110002-66110024 ACAAGGGTGCAGAGGGGCCCCGG + Intronic
1130149018 15:81297256-81297278 TCCAGGGTGGGGAGCCTCCTGGG + Intronic
1132253135 15:100349726-100349748 ACCAGCGTGAAGAGGGTCTCAGG - Intergenic
1133121476 16:3611368-3611390 ACTCGGGTGGAGAGGGGCCGGGG - Intronic
1133180311 16:4049264-4049286 ACCAGAGAGAAGAGGGTCCAGGG + Intronic
1134093349 16:11403154-11403176 ACCAGCGTGCACAGGGGCCTCGG - Intronic
1135743712 16:24998186-24998208 AAGTGGGAGGAGAGGGTCCTGGG + Intronic
1135796182 16:25445018-25445040 ACCTGGGAGGAGAGGGATCTGGG + Intergenic
1136842331 16:33548873-33548895 ACCACGGGGGACAGGGCCCTGGG - Intergenic
1137466940 16:48718361-48718383 AACAGGGTGGAGAGGAGCCTTGG - Intergenic
1137633463 16:49965152-49965174 AAAAGGGTGGAGAGAGTCCAAGG - Intergenic
1138139727 16:54557804-54557826 CCCAGGGGAGAGAGGGTCCAGGG + Intergenic
1138553088 16:57757738-57757760 CCCGGGGTGGTCAGGGTCCTCGG + Intergenic
1139438859 16:66953813-66953835 CCCTGGGTGGAGAGGCTCCTGGG - Intergenic
1139599902 16:67980232-67980254 CCCAGCGTGGAGAGGGCTCTGGG + Exonic
1139706942 16:68747314-68747336 AGGAGGGAGGAGAGGGTCCCAGG + Intronic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1141693424 16:85608920-85608942 GCCAGGATGGAGAAGGACCTTGG + Intergenic
1142124587 16:88403851-88403873 ACCAGGCTGAGGAGTGTCCTGGG - Intergenic
1142294413 16:89211130-89211152 GACAGGGTGGAGGGAGTCCTTGG - Intergenic
1203152496 16_KI270728v1_random:1849170-1849192 ACCACGGGGGACAGGGCCCTGGG - Intergenic
1142673714 17:1500227-1500249 ACCAAGGTGGAGTGGGTCTGGGG - Intronic
1143465041 17:7131014-7131036 ACCAGGCTGGAGATGGGCCGGGG - Intergenic
1144670478 17:17129993-17130015 ACCAGGGAGGAGAGGGGCTCAGG + Intronic
1145058220 17:19716763-19716785 ACTAGGGAGGACAGGTTCCTGGG + Intronic
1145997326 17:29112157-29112179 ACGAGGGTGGAGGAGGGCCTCGG - Intronic
1147322380 17:39653947-39653969 ACTTGGGTGCAGAGGGACCTTGG - Intronic
1148769727 17:50059957-50059979 ACCAGTGGGGAGAGGGGGCTGGG + Intronic
1150382243 17:64729981-64730003 ACAAGGCTGGACAAGGTCCTGGG + Intergenic
1151448314 17:74181602-74181624 CCCAGGGTGGGGAGGGGGCTTGG - Intergenic
1151745599 17:76010125-76010147 ACCCAGGTGGAGAGGGACCCCGG - Exonic
1152224092 17:79084741-79084763 AGAAGTGTGGAGAGGCTCCTGGG + Intronic
1152231305 17:79115380-79115402 ACCAGGTGGGCGAGGGGCCTGGG - Intronic
1152288312 17:79424871-79424893 ACCATGGTGGGGAGGGGCTTTGG - Intronic
1152436164 17:80277812-80277834 ACCATGGTGAGGAGGGTGCTAGG + Intronic
1153225158 18:2894238-2894260 AGGAGGGTGGAGAGGGTCCGAGG + Intronic
1154338298 18:13483040-13483062 AGCAAGGTGGAGAGAGGCCTTGG + Intronic
1157105318 18:44769088-44769110 AGGAGGCTGGAGAGGGTGCTGGG + Intronic
1158244401 18:55414658-55414680 GCCTGGGTGGAGAGCATCCTTGG - Intronic
1160052167 18:75444054-75444076 ACTAGGGTGGGGAGGCTGCTTGG - Intergenic
1160874705 19:1291579-1291601 TCCAGGGTGGAGAAGCTCCCGGG - Intronic
1161567765 19:5012996-5013018 ACCAGGGTGGACAGAGGCCTAGG + Intronic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1162735673 19:12745691-12745713 ACCATCGTGGAGCGGGGCCTGGG + Exonic
1162802865 19:13120527-13120549 CCCAGGTTGGAGGGTGTCCTGGG - Intronic
1163613021 19:18310746-18310768 CCCAGGCTGGAGGGGGCCCTGGG - Intronic
1164941197 19:32253244-32253266 ACCAGGGAAGAGAAGGTCCAAGG - Intergenic
1165153963 19:33776665-33776687 ACCAAGCTGGGGAGGGCCCTGGG - Intergenic
1165481217 19:36065643-36065665 TACAGGGTGGATAGGGTCTTAGG + Intronic
1165827766 19:38714914-38714936 AGAAGGATGGAGAGGGGCCTGGG + Intronic
1166810503 19:45511524-45511546 TGCAGGGAGGAGTGGGTCCTGGG + Intronic
1167706335 19:51083190-51083212 ACCAGGGTGGGGAGTGTCAGAGG + Intronic
1168343034 19:55636605-55636627 ACCAGGATGGAGCTGGGCCTTGG + Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
928883158 2:36120059-36120081 AAGAGGCTGGAGAGAGTCCTAGG - Intergenic
931636303 2:64343685-64343707 CCCAGGATGGTGAGGTTCCTGGG + Intergenic
933559671 2:83874687-83874709 ACCAGGGCGGAGAGGGTCGTAGG + Intergenic
933917854 2:87014598-87014620 ACAAAGGTGAAGAGGGTCCCAGG + Intronic
934005141 2:87755316-87755338 ACAAAGGTGAAGAGGGTCCCAGG - Intronic
935768098 2:106389408-106389430 ACAAAGGTGAAGAGGGTCCCAGG - Intergenic
936475047 2:112832410-112832432 ACTTGGGTGGACATGGTCCTGGG + Intronic
937122733 2:119452008-119452030 ACCAGGATGGAGAGGATCACAGG + Exonic
937932997 2:127220035-127220057 GCCAGGTTGGCGAGGGTCCTCGG + Intronic
938489724 2:131755261-131755283 ACCAGGGTGGCCAGGGTCCATGG - Intronic
938719801 2:134056443-134056465 ACTTGGGTGGAGTGGGTCCCTGG - Intergenic
938779952 2:134575930-134575952 CCCAGGATGCAGAAGGTCCTAGG + Intronic
939628759 2:144510359-144510381 ACCAGAGAGGTGAGGGCCCTGGG - Intronic
940883418 2:158968869-158968891 CCCGGGGTGGAGAGGGTGATGGG + Intronic
944495884 2:200306928-200306950 CCCGGCGTGGAGGGGGTCCTGGG - Intronic
946027314 2:216679641-216679663 ACCTAGGAGGAGGGGGTCCTGGG + Intronic
946166357 2:217866533-217866555 ACCAGGCTGCAGAGGTTCCCAGG + Intronic
946464151 2:219896568-219896590 ACAGAGCTGGAGAGGGTCCTGGG + Intergenic
946592536 2:221266553-221266575 ACTAGGGAAGAGAGGGTGCTTGG - Intergenic
948389205 2:237599945-237599967 AGCAGCCTGGAGAGGGGCCTCGG + Intronic
948607560 2:239145880-239145902 TCCAAAGTGGAGAAGGTCCTGGG - Intronic
948921407 2:241067668-241067690 ACCAGGCTTGGGAGGGTGCTGGG - Intronic
1169268593 20:4182360-4182382 GCCAGGGTGGAGAGGAGCCCCGG + Exonic
1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG + Intergenic
1173323606 20:42011951-42011973 ACCAGGAAGGAGAGGGTCTATGG - Intergenic
1174286910 20:49480496-49480518 ACAAGGATGTAGAGGCTCCTGGG - Intronic
1174542227 20:51298575-51298597 ACCAGGGCGGAGAGAGATCTTGG + Intergenic
1175276442 20:57774172-57774194 ACCATGGTGGACAGGGCACTGGG - Intergenic
1175327442 20:58139701-58139723 ACCAGGCTGGGCAGGTTCCTAGG + Intergenic
1175336547 20:58199912-58199934 AGAAGGGAGGAGAGGGGCCTGGG + Intergenic
1176017666 20:62944349-62944371 ACCCGGGGGAAGAGGGACCTGGG - Intronic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1176706591 21:10123065-10123087 ACCAGGGTTGCCAGGGTCCATGG - Intergenic
1179981394 21:44897675-44897697 TTCAGGGTGGACAGGGCCCTGGG - Intronic
1180953208 22:19730091-19730113 ATCAGTGGGGAGGGGGTCCTGGG - Intergenic
1180959025 22:19754397-19754419 ACCAGGGAGCAGATGGTGCTGGG + Intergenic
1181521862 22:23452838-23452860 ACCAGGCTGGAGAGTGGCCTGGG - Intergenic
1181689253 22:24549270-24549292 GCAAGGGTGCAGAGGGTGCTAGG - Intronic
1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG + Intronic
1182551415 22:31102784-31102806 ACCAGGTTGGAGAGGGCGGTCGG + Intronic
1183306222 22:37084570-37084592 GCCAGGGTGGAGAGGGCTGTGGG - Intronic
1183418597 22:37697181-37697203 GCCTGGATGGAGAGGGTCCCGGG + Intronic
1183676321 22:39300734-39300756 GCCTGGGAGGAGCGGGTCCTGGG + Intergenic
1184430301 22:44438407-44438429 ACCAGGGTTGAGAGGCTGGTCGG + Intergenic
1184472014 22:44701713-44701735 GCCCGGGTGGAGTGGGTTCTTGG + Intronic
1185048513 22:48541253-48541275 CCCAGGGGGTATAGGGTCCTGGG - Intronic
1185315404 22:50176820-50176842 AGGAGGCTGGAGAGGCTCCTGGG + Intronic
950707820 3:14793874-14793896 CCCAGGGTGGCGAGGGGCCTGGG - Intergenic
953824273 3:46236490-46236512 CCCAGGGTGGAGAGGTTACATGG - Intronic
956281834 3:67565782-67565804 ACCATTGTGGAGAGGCTCCAAGG - Intronic
956674544 3:71722014-71722036 ACAAGGGAGAAAAGGGTCCTGGG + Intronic
958716406 3:97787773-97787795 ACCAGAGGGCAGATGGTCCTAGG + Intronic
961352139 3:126310913-126310935 AGCAGGGTGGAGATGGTTCAGGG - Intergenic
962930406 3:140030617-140030639 ACCAGGGTGGAGAGGACACAGGG + Intronic
963920364 3:150899488-150899510 ACCAGAAAGGAGAGAGTCCTGGG + Intronic
963998879 3:151743763-151743785 ACCAGGATACAAAGGGTCCTGGG + Intronic
964814356 3:160700998-160701020 CTCAGTGTGGAGAGGGTGCTGGG + Intergenic
964980375 3:162670319-162670341 CCCAGGTGGGAGAGGGTCCCTGG + Intergenic
967630322 3:191737683-191737705 GCCAGGTTGGAGGGGGTCCCTGG - Intergenic
968427201 4:531963-531985 ACCAGGGAGGGCTGGGTCCTGGG - Intronic
968502732 4:958538-958560 ACCAGGGAGGACAGGATGCTGGG + Exonic
968742978 4:2340674-2340696 ACCTCCGTGGAGTGGGTCCTGGG - Intronic
969058531 4:4416755-4416777 ACCAGAGCAGAGAGGGGCCTTGG - Intronic
969358630 4:6647138-6647160 AGCAGGGTGGAGGAGCTCCTTGG + Intergenic
969717075 4:8872924-8872946 ACTCGGGTGGAGAGGGGCCCGGG - Intergenic
975721103 4:77249507-77249529 ACCAGGGGGTAGAGGGTATTTGG - Intronic
976609114 4:87011131-87011153 CCCAGGGTGGAGAAGGGCCAGGG - Intronic
979374660 4:119932051-119932073 ACCATTGTTGAGAGGGTTCTGGG - Intergenic
980122845 4:128745344-128745366 CCCAGGGTGGACATGGTGCTCGG + Intergenic
984144867 4:176047822-176047844 ATCAGGGAGGAGAGGGTCAATGG + Intergenic
984960836 4:185096213-185096235 ACCAGGTGGCAGAGTGTCCTTGG - Intergenic
990574629 5:57112271-57112293 AGCAGGGTGGAGAGAGGACTGGG + Intergenic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
991469906 5:66956838-66956860 ACCAAGGTGTAGAGGGTACCAGG + Intronic
991489057 5:67165706-67165728 AACAGGCTTGGGAGGGTCCTGGG - Exonic
996787749 5:127258965-127258987 ACTATGGTGGTGAGGGTCATTGG + Intergenic
997194395 5:131968286-131968308 ACCAACGTGCACAGGGTCCTGGG + Intronic
997469236 5:134107577-134107599 ACCAGGGTGGGGAGGGCACCAGG - Intergenic
998162718 5:139822513-139822535 TCCAGGGTGGTCAGGCTCCTGGG + Intronic
1000754724 5:165144085-165144107 CCCAGGGTGGAGAGGGTGAGGGG - Intergenic
1001366425 5:171145508-171145530 ACCAGGGAGCAGAGGAACCTTGG - Intronic
1002467871 5:179416752-179416774 ACCTGGGTGGACAGGGGCATGGG - Intergenic
1003495624 6:6660895-6660917 ACCGGGGTGGCAAGGGGCCTGGG - Intergenic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1004485232 6:16060230-16060252 GCCAGGTGGGAGGGGGTCCTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006580208 6:35072723-35072745 GCCAGGAGGGAGAGGGTCCTGGG + Intronic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1009907796 6:69890833-69890855 GCCAGGTGGGAGGGGGTCCTTGG - Intronic
1013612927 6:111811990-111812012 CCTGGGGTGCAGAGGGTCCTAGG - Intronic
1015441455 6:133251702-133251724 ACCAGGGGAGGGAGGGTCCCTGG - Intronic
1016979075 6:149837738-149837760 TCAAGGGTGGAGAGAGACCTGGG - Intronic
1018128942 6:160709582-160709604 ACAAAGGTGAAGAGGGTCCCAGG - Intronic
1018359695 6:163054877-163054899 GCCAGGGGGGAGGCGGTCCTTGG - Intronic
1018650207 6:165986639-165986661 ACCAGAAAGGAGAGGCTCCTTGG + Intergenic
1019178885 6:170175283-170175305 ACCTGGGCTGAGGGGGTCCTGGG + Intergenic
1019275791 7:174905-174927 ACAAGCCTGGAGAGGATCCTGGG - Intergenic
1019589476 7:1823647-1823669 ACCAGGCTGGAGAGTGGCCTGGG + Intronic
1020001800 7:4760375-4760397 TCCAGGGTGGAGAGTGGCCTAGG - Intronic
1021628835 7:22623555-22623577 GCCAGGGTGGAGAGCATCTTTGG - Intronic
1024355402 7:48409478-48409500 GCCAGGGTGGAGGGGGACTTGGG - Intronic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1028756510 7:94440992-94441014 GCCAGGTGGGAGAGGGTCCCTGG - Intergenic
1029622706 7:101699976-101699998 ACCACAGTGGAGAGGGCCCTGGG - Intergenic
1030866042 7:114702856-114702878 ACCAGGGCGGAGAGGTTGTTGGG + Intergenic
1034481043 7:151320726-151320748 CCCAGGGTGGAGTGGATCATGGG - Intergenic
1035376648 7:158411055-158411077 GCCAGGGAGGAGAGGGCCCCGGG - Intronic
1036709943 8:11071803-11071825 CCCAGTGGGGAGAGGGTGCTGGG - Intronic
1037550489 8:19966362-19966384 AAAAGGGTGGAGAGGTTCCTGGG + Exonic
1039352555 8:36779151-36779173 GCCAGGTTGGAAAGGGTCCCCGG + Intergenic
1040073556 8:43206993-43207015 AACAGGGGTGAGAAGGTCCTGGG + Intergenic
1040496033 8:47966291-47966313 ACCCGGGTGGAGATGGACCGCGG + Exonic
1041415364 8:57602136-57602158 GCTGGGGTGGAGAGTGTCCTAGG - Intergenic
1042316112 8:67427716-67427738 ACAAGGGTGGAAACGGGCCTTGG - Intronic
1044743470 8:95350712-95350734 ACCTGGGTGGTGAGGGAGCTGGG + Intergenic
1045515660 8:102858507-102858529 ACTAGGTTGGTGAGGGTACTTGG - Intronic
1048502380 8:134990178-134990200 ACCAGCTTTGGGAGGGTCCTGGG + Intergenic
1048617871 8:136098846-136098868 ACAAGTCTGGATAGGGTCCTAGG - Intergenic
1049204894 8:141359111-141359133 AGCAGGGTGGGGAGGCTCGTGGG + Intronic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1050893640 9:10857108-10857130 ACCTGGGTGAAAAGTGTCCTAGG + Intergenic
1052988025 9:34502153-34502175 ACCAGGGTGGGGAGGGGCAGTGG + Intronic
1053643884 9:40110184-40110206 ACCAGGGTTGCCAGGGTCCATGG - Intergenic
1053762268 9:41355305-41355327 ACCAGGGTTGCCAGGGTCCATGG + Intergenic
1054324739 9:63707412-63707434 ACCAGGGTTGCCAGGGTCCATGG - Intergenic
1054540864 9:66266424-66266446 ACCAGGGTTGCCAGGGTCCATGG + Intergenic
1056992831 9:91426462-91426484 ACCAGGGTGGGGAGGCTTCTAGG + Intergenic
1057516970 9:95729687-95729709 TCCTGGGTGGAGAGGGGACTTGG + Intergenic
1057714655 9:97482251-97482273 ACATGGGAGGAGAGGGACCTGGG - Intronic
1058622553 9:106898678-106898700 GTCAGGGTGGAGAGAGTCATAGG + Intronic
1060400757 9:123348368-123348390 ACCAGAGAGGAGGGGATCCTGGG - Intergenic
1060973630 9:127752958-127752980 ACCAGGGTGGAGAGGGCAGGTGG + Intronic
1061294986 9:129672121-129672143 CCCAGGGTGGAAGGGGACCTTGG + Intronic
1061834261 9:133318410-133318432 TCCAGGGTCGTGAGGGTCATGGG - Intergenic
1061872066 9:133526443-133526465 GCCAGTGTTGAGACGGTCCTTGG - Intronic
1062108380 9:134768047-134768069 ACCAGGGAGGACAGGGTGGTGGG + Intronic
1062238068 9:135522122-135522144 TCCAGGGTCGTGAGGGTCATGGG - Exonic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062444341 9:136587418-136587440 ACCAGGGAGGAGAGGTGACTGGG + Intergenic
1062538307 9:137030462-137030484 TTCAGGGTGGGGAGGGTCCTCGG + Exonic
1185848736 X:3465248-3465270 AGCAGGGTTGGGAGGGCCCTGGG - Intergenic
1185865292 X:3618946-3618968 ACCTGGCTGGATAGGCTCCTCGG + Intronic
1186410819 X:9342951-9342973 GCCTGGGTGGAGAGGGACTTGGG + Intergenic
1190876415 X:54463359-54463381 ACTAGGGTGGAGTGGATGCTGGG - Intronic
1191058148 X:56265379-56265401 AGCAGGCTGGAGAGGAGCCTTGG - Exonic
1191893878 X:65972790-65972812 AACAGGGTGGGAAGTGTCCTTGG - Intergenic
1192625524 X:72723459-72723481 GCCAGGGTGTAGAGGCTCCCAGG - Intergenic
1192726496 X:73758728-73758750 ATCAGGAAGCAGAGGGTCCTTGG - Intergenic
1192872895 X:75201801-75201823 TCCAGGGTGGAGAGGGGTCAGGG - Intergenic
1193561403 X:83022191-83022213 ACCAGGGTGGAATGTGACCTAGG + Intergenic
1193765828 X:85528088-85528110 AACAGTATGAAGAGGGTCCTCGG - Intergenic
1194667565 X:96692589-96692611 ACAAGGGTGGATAGACTCCTTGG + Intronic
1197195672 X:123698502-123698524 ACCAGGGTGGCGAAAGTCATGGG - Intronic
1198070656 X:133145181-133145203 ACCTGGGTGGAAAGGGAACTAGG - Intergenic
1199234278 X:145472428-145472450 GCCAGGTGGGAGAGGGTCCCCGG + Intergenic
1200798400 Y:7362549-7362571 ACCTGGCTGGACAGGCTCCTTGG - Intergenic
1200814907 Y:7521582-7521604 AGCAGGGTTGGGAGGGCCCTGGG + Intergenic
1200835415 Y:7727021-7727043 ACCAAGGGGGACAGGGTCCCTGG + Intergenic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic