ID: 1025812179

View in Genome Browser
Species Human (GRCh38)
Location 7:64882324-64882346
Sequence GACCACGGAGACGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025812174_1025812179 -8 Left 1025812174 7:64882309-64882331 CCTCCAGGGGGAGCCGACCACGG 0: 1
1: 0
2: 2
3: 15
4: 113
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812164_1025812179 20 Left 1025812164 7:64882281-64882303 CCCACCTCACGGTCTCCAATCGC 0: 1
1: 0
2: 1
3: 7
4: 103
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812172_1025812179 -2 Left 1025812172 7:64882303-64882325 CCTCCTCCTCCAGGGGGAGCCGA 0: 1
1: 0
2: 5
3: 41
4: 295
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812165_1025812179 19 Left 1025812165 7:64882282-64882304 CCACCTCACGGTCTCCAATCGCC 0: 1
1: 0
2: 1
3: 13
4: 86
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812169_1025812179 5 Left 1025812169 7:64882296-64882318 CCAATCGCCTCCTCCTCCAGGGG 0: 1
1: 0
2: 4
3: 34
4: 301
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812166_1025812179 16 Left 1025812166 7:64882285-64882307 CCTCACGGTCTCCAATCGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 108
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1025812173_1025812179 -5 Left 1025812173 7:64882306-64882328 CCTCCTCCAGGGGGAGCCGACCA 0: 1
1: 0
2: 6
3: 29
4: 156
Right 1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025812179 Original CRISPR GACCACGGAGACGCCCCAGG AGG Intronic
900097663 1:946632-946654 GGCCACGGGGATACCCCAGGAGG + Intronic
903216402 1:21845931-21845953 GACCAAGGAGCCGGCTCAGGTGG - Intronic
903603814 1:24560440-24560462 GACTAAGGAAACACCCCAGGTGG - Intronic
906113125 1:43337853-43337875 GACCATGAAGAGGGCCCAGGAGG - Exonic
911549671 1:99264128-99264150 GACCTAGGAGGCTCCCCAGGAGG + Exonic
912796011 1:112694080-112694102 GTCCTCGGAGACACACCAGGAGG + Exonic
913385684 1:118255909-118255931 GACCAGGGAGAGGGCCCTGGGGG + Intergenic
918102874 1:181391654-181391676 GACCACTGGGAGGCCCCAGGGGG - Intergenic
922804665 1:228379049-228379071 GAGGACGGAGACGCCCCGAGGGG - Intergenic
1069532191 10:69227606-69227628 GAACATGGAGATGCTCCAGGAGG - Intronic
1070689550 10:78514466-78514488 GGCCATGGAGAGGCCCCAAGTGG + Intergenic
1071518273 10:86313553-86313575 TGCCACGGAGACTCCCCTGGTGG - Intronic
1074781206 10:116803557-116803579 GCCCACACAGAAGCCCCAGGCGG - Intergenic
1077113579 11:872851-872873 GACCACAGAGGCCCCCCAGGAGG - Intronic
1078616325 11:12869328-12869350 TGCCACGGAGCAGCCCCAGGGGG - Intronic
1079180430 11:18188965-18188987 GCCCACGGTGATGCCCCAGCCGG - Exonic
1084301330 11:68254493-68254515 AACCACGGAGTGGCGCCAGGCGG - Intergenic
1096694329 12:53339054-53339076 GACCAGGGAGAGGCGCCATGTGG + Intronic
1100744702 12:97633149-97633171 GACCACGAAAATGCCCCTGGTGG + Intergenic
1102433153 12:112899163-112899185 GACCTGGGAAACGTCCCAGGTGG + Intergenic
1102646776 12:114408923-114408945 TACCGCGTAGACGCCCCTGGTGG + Intergenic
1104682915 12:130763631-130763653 GACCACGCAGAGGCTCCTGGAGG + Intergenic
1107727403 13:43312875-43312897 GACCAAGCAGAAGCCCCAGTCGG + Intronic
1111795050 13:92908794-92908816 GACTACAGAGAGGCCCCTGGAGG - Intergenic
1113670134 13:112170704-112170726 GACTGCGGGGACTCCCCAGGTGG - Intergenic
1114643786 14:24242314-24242336 GACCATGGCTACGCCCCTGGTGG - Exonic
1119297073 14:73541629-73541651 GACCATGGAGACGCTCCATCTGG + Exonic
1119301313 14:73573524-73573546 GACCATGGAGACGCTCCATCTGG + Exonic
1119545677 14:75469766-75469788 GGCCAGGGAGACGCCCAACGAGG + Exonic
1122791894 14:104187517-104187539 GCCCCTGGAGATGCCCCAGGAGG + Intergenic
1122908826 14:104816375-104816397 GAACACGGAGTCGGCCCAGAGGG + Intergenic
1123999317 15:25741365-25741387 AACCACAGAGACGCCTCAGCAGG - Intronic
1125746617 15:42001419-42001441 GACCACGAAGCTGTCCCAGGAGG + Intronic
1127354250 15:58182806-58182828 GACCACTTAGGTGCCCCAGGTGG + Intronic
1132501599 16:286903-286925 GCCCACGGAGGAGCCCCCGGAGG + Exonic
1132767583 16:1542204-1542226 GGCCACTGAGAAGCCCCATGGGG + Intronic
1132790055 16:1680892-1680914 GAGCATGGAGACCCCCGAGGAGG + Intronic
1132819217 16:1854488-1854510 GTCCACGTAGATGCCCCAGAGGG - Intronic
1133225581 16:4338856-4338878 GAGCAGGGAGAGGCCCCAGATGG - Exonic
1133357609 16:5148166-5148188 GAGCAGGGAGACCCCTCAGGTGG + Intergenic
1134847599 16:17453574-17453596 GAGCACGGAGACTTCCCCGGAGG - Intronic
1136278217 16:29191970-29191992 GACCACGTTGCCGGCCCAGGTGG - Intergenic
1141185794 16:81786124-81786146 GATCATGGAGACGCGGCAGGTGG + Exonic
1141526893 16:84617677-84617699 GGCCACGGAGAAGCCCGCGGGGG + Intronic
1141877092 16:86833287-86833309 GACCCCGGAGACTTCACAGGCGG + Intergenic
1142082594 16:88158004-88158026 GACCACGTTGCCGGCCCAGGTGG - Intergenic
1142498933 17:321592-321614 GGCAACAGAGACGGCCCAGGTGG + Intronic
1142582485 17:950752-950774 GACCACAGAGACAACCCAGTGGG + Intronic
1143490641 17:7283558-7283580 GGCCACGGAGAGGGCCCAGAGGG - Exonic
1144357685 17:14461596-14461618 CACCACGGAGAGTCCCCAGCTGG - Intergenic
1145729051 17:27158680-27158702 GACCATGGAGACGGCGGAGGAGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147965724 17:44193358-44193380 GAACACGGGGCCACCCCAGGAGG + Exonic
1148073536 17:44922323-44922345 CACCACGGAGGCTCCCCAGGTGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151725087 17:75878762-75878784 GACCACGCGGACTCCCCTGGGGG - Intergenic
1152812420 17:82388336-82388358 GACCTGGGAGACGTGCCAGGTGG + Intergenic
1153457505 18:5296190-5296212 GACTACGGGGCCGCCCCCGGAGG + Intronic
1160560918 18:79755289-79755311 GACCCCGGAGAACCCACAGGTGG - Exonic
1160828420 19:1091407-1091429 GAACACGGATAGGCCCCTGGAGG + Intronic
1161000365 19:1907738-1907760 GACCACTGGGACCCCTCAGGAGG - Intronic
1165864955 19:38931268-38931290 TACCACAGGGACGGCCCAGGTGG + Exonic
1167613367 19:50517814-50517836 GGCCACGGACACGGCCGAGGCGG + Exonic
1167920862 19:52782088-52782110 GACCACAGGCACGCCCCACGAGG - Intronic
925894847 2:8463262-8463284 GGCCACAGAGAAGACCCAGGTGG + Intergenic
927089839 2:19701933-19701955 AACCAAGGAGTCCCCCCAGGTGG + Intergenic
927861566 2:26563003-26563025 GTGCTTGGAGACGCCCCAGGCGG + Intronic
928389733 2:30899884-30899906 GACCTCTGCGACGCCCCACGTGG - Intergenic
935407742 2:102726748-102726770 GACCACAGAGGTGGCCCAGGAGG + Intronic
938305515 2:130251926-130251948 GACCGCTGAGGCTCCCCAGGTGG + Intergenic
945088721 2:206159383-206159405 GACCACGACGACCCCCTAGGAGG + Intronic
948939613 2:241189331-241189353 GACCATGGAGGCGCCGCAGGAGG - Intronic
1168953756 20:1819949-1819971 GACCACAGAGAGGCTCCAGCAGG + Intergenic
1173846547 20:46192274-46192296 GACCATGGCCACGCTCCAGGAGG + Intronic
1175646422 20:60676691-60676713 GACCACCCAGACGGCCCAGGTGG - Intergenic
1175981943 20:62743109-62743131 GAGCACGGAGCCGCCCCTGCTGG + Intronic
1179826412 21:43968590-43968612 GCTCAAAGAGACGCCCCAGGAGG - Intronic
1180982782 22:19886727-19886749 GAGCACAGAGCCGCCCCATGGGG - Intronic
950015928 3:9754879-9754901 CACCAAGGTGAGGCCCCAGGGGG + Exonic
953434059 3:42864801-42864823 GGCCACGGAGATGCCCCAGAAGG - Exonic
961530013 3:127534856-127534878 CACCTGGAAGACGCCCCAGGGGG - Intergenic
968465513 4:748000-748022 GAGCACAGAGACGCGCCCGGAGG - Intronic
968962002 4:3750427-3750449 GAGCACGGAAACGTCCCTGGAGG - Intergenic
971280524 4:25239419-25239441 GAGCACGGTGCCGGCCCAGGGGG + Intronic
978337059 4:107680843-107680865 GGCCACTGAGACATCCCAGGAGG - Intronic
981807085 4:148729005-148729027 GACTAGGGAGAGGCTCCAGGTGG + Intergenic
982573307 4:157076517-157076539 GCCCGCGGAGACGCTCCGGGTGG + Intronic
985618159 5:937011-937033 GACCACAGACATGCCACAGGAGG - Intergenic
985656799 5:1136116-1136138 GACTGCGGAGAGGCCACAGGAGG + Intergenic
985660929 5:1156134-1156156 GACCTTGGAGACGCCCCAGCCGG + Intergenic
985774977 5:1836793-1836815 ACCCACGGAAAGGCCCCAGGGGG - Intergenic
991228004 5:64295302-64295324 GGCAACAGAGATGCCCCAGGTGG - Intronic
998430144 5:142063627-142063649 GACCACTGAGACCCCCAACGAGG + Intergenic
1001476544 5:172054770-172054792 GCCCAGGGAGACCCCTCAGGGGG + Intronic
1001940529 5:175736716-175736738 GACCACAGCCATGCCCCAGGAGG + Intergenic
1003328750 6:5112185-5112207 GACCACACAGATGGCCCAGGTGG - Intronic
1017967455 6:159278591-159278613 GACCACGGGGACACTCCAGATGG + Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1018967971 6:168503436-168503458 GAGCACAGAGACTCACCAGGAGG - Intronic
1019144614 6:169968796-169968818 GACCACCGAGACCGCACAGGTGG - Intergenic
1019642638 7:2112616-2112638 GACCAAGGAGACAGCACAGGAGG + Intronic
1019765006 7:2843775-2843797 GACCACGGAGGGGCCCGGGGCGG + Intronic
1025812179 7:64882324-64882346 GACCACGGAGACGCCCCAGGAGG + Intronic
1029129946 7:98322340-98322362 GACCACGCAGACGTCCCATTGGG + Intronic
1029704164 7:102267072-102267094 GACCACTGAGCCCCCCCAGCCGG - Intronic
1029983034 7:104896712-104896734 GAGCAGGGAGAGGCCACAGGAGG + Intronic
1034437520 7:151070244-151070266 GACCATGGTGATGCCCCAGCAGG - Exonic
1037879579 8:22566219-22566241 GACCCGGGAGACGCCCTGGGAGG + Intronic
1039946007 8:42129202-42129224 GACCACCGAGAAGCCACAGTGGG - Intergenic
1042945757 8:74153032-74153054 AACCAGGGAGAAGCCCCAGGTGG + Intergenic
1044544455 8:93444174-93444196 CAGAAGGGAGACGCCCCAGGAGG + Intergenic
1048326951 8:133447225-133447247 GAGCACTGAGCAGCCCCAGGTGG - Intergenic
1049535464 8:143178590-143178612 CCCCAGGGGGACGCCCCAGGCGG - Intergenic
1049852613 8:144841227-144841249 GAGCACTGTGAGGCCCCAGGTGG - Intronic
1062086580 9:134652356-134652378 GGGCAAGGAGATGCCCCAGGTGG + Intronic
1062383002 9:136296619-136296641 GACCTCGAAGACGCCCCAGAAGG + Intronic
1062392236 9:136338428-136338450 GACCCCAGAGAGGCCCCAGTGGG + Intronic
1185508284 X:644524-644546 GACCACGGCGGCGGCCGAGGCGG - Exonic
1200212823 X:154354462-154354484 GGCCCCGGAGAGGCCCCTGGTGG - Exonic
1200697473 Y:6373739-6373761 GACCACGGAGATGGCCCAAAGGG - Intergenic
1200915081 Y:8564458-8564480 GACCATGGAGACACCCAAAGTGG + Intergenic
1200939163 Y:8764531-8764553 AACCACGGAGATGCCCCAAAGGG - Intergenic
1201036640 Y:9790960-9790982 GACCACGGAGATGGCCCAAAGGG + Intergenic
1202129618 Y:21597957-21597979 GACCACGGAGATGGCCCAAGGGG - Intergenic