ID: 1025814507

View in Genome Browser
Species Human (GRCh38)
Location 7:64898854-64898876
Sequence GGCTAGATACTTACTGAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025814503_1025814507 15 Left 1025814503 7:64898816-64898838 CCTTTGGGGTCTTAATTTAACTG 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1025814507 7:64898854-64898876 GGCTAGATACTTACTGAATCCGG No data
1025814502_1025814507 24 Left 1025814502 7:64898807-64898829 CCACATGCACCTTTGGGGTCTTA No data
Right 1025814507 7:64898854-64898876 GGCTAGATACTTACTGAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025814507 Original CRISPR GGCTAGATACTTACTGAATC CGG Intronic