ID: 1025819311

View in Genome Browser
Species Human (GRCh38)
Location 7:64947634-64947656
Sequence GCAGGGCCATGCAGCTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025819311_1025819321 16 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819321 7:64947673-64947695 GGGACGCTCCACACCCTGTGTGG No data
1025819311_1025819323 18 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819323 7:64947675-64947697 GACGCTCCACACCCTGTGTGGGG No data
1025819311_1025819328 26 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819328 7:64947683-64947705 ACACCCTGTGTGGGGGCGGAGGG No data
1025819311_1025819324 19 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819324 7:64947676-64947698 ACGCTCCACACCCTGTGTGGGGG No data
1025819311_1025819329 27 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819311_1025819327 25 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819327 7:64947682-64947704 CACACCCTGTGTGGGGGCGGAGG No data
1025819311_1025819316 -4 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819316 7:64947653-64947675 CTGCCCGCTGACGCCCGGTCGGG No data
1025819311_1025819315 -5 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819315 7:64947652-64947674 CCTGCCCGCTGACGCCCGGTCGG No data
1025819311_1025819325 22 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819325 7:64947679-64947701 CTCCACACCCTGTGTGGGGGCGG No data
1025819311_1025819322 17 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819322 7:64947674-64947696 GGACGCTCCACACCCTGTGTGGG No data
1025819311_1025819312 -9 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819312 7:64947648-64947670 TGGCCCTGCCCGCTGACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025819311 Original CRISPR GCAGGGCCATGCAGCTCCTG TGG (reversed) Intergenic
No off target data available for this crispr