ID: 1025819313

View in Genome Browser
Species Human (GRCh38)
Location 7:64947651-64947673
Sequence CGACCGGGCGTCAGCGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025819313_1025819335 25 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819335 7:64947699-64947721 CGGAGGGGACGCGGTGGGTGCGG No data
1025819313_1025819336 30 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819336 7:64947704-64947726 GGGACGCGGTGGGTGCGGCCTGG No data
1025819313_1025819322 0 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819322 7:64947674-64947696 GGACGCTCCACACCCTGTGTGGG No data
1025819313_1025819327 8 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819327 7:64947682-64947704 CACACCCTGTGTGGGGGCGGAGG No data
1025819313_1025819321 -1 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819321 7:64947673-64947695 GGGACGCTCCACACCCTGTGTGG No data
1025819313_1025819325 5 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819325 7:64947679-64947701 CTCCACACCCTGTGTGGGGGCGG No data
1025819313_1025819333 19 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819333 7:64947693-64947715 TGGGGGCGGAGGGGACGCGGTGG No data
1025819313_1025819329 10 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819313_1025819332 16 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG No data
1025819313_1025819334 20 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819334 7:64947694-64947716 GGGGGCGGAGGGGACGCGGTGGG No data
1025819313_1025819324 2 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819324 7:64947676-64947698 ACGCTCCACACCCTGTGTGGGGG No data
1025819313_1025819323 1 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819323 7:64947675-64947697 GACGCTCCACACCCTGTGTGGGG No data
1025819313_1025819328 9 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819328 7:64947683-64947705 ACACCCTGTGTGGGGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025819313 Original CRISPR CGACCGGGCGTCAGCGGGCA GGG (reversed) Intergenic
No off target data available for this crispr