ID: 1025819318

View in Genome Browser
Species Human (GRCh38)
Location 7:64947657-64947679
Sequence GCGTCCCGACCGGGCGTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025819318_1025819336 24 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819336 7:64947704-64947726 GGGACGCGGTGGGTGCGGCCTGG No data
1025819318_1025819329 4 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819318_1025819322 -6 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819322 7:64947674-64947696 GGACGCTCCACACCCTGTGTGGG No data
1025819318_1025819334 14 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819334 7:64947694-64947716 GGGGGCGGAGGGGACGCGGTGGG No data
1025819318_1025819332 10 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG No data
1025819318_1025819335 19 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819335 7:64947699-64947721 CGGAGGGGACGCGGTGGGTGCGG No data
1025819318_1025819325 -1 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819325 7:64947679-64947701 CTCCACACCCTGTGTGGGGGCGG No data
1025819318_1025819333 13 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819333 7:64947693-64947715 TGGGGGCGGAGGGGACGCGGTGG No data
1025819318_1025819323 -5 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819323 7:64947675-64947697 GACGCTCCACACCCTGTGTGGGG No data
1025819318_1025819327 2 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819327 7:64947682-64947704 CACACCCTGTGTGGGGGCGGAGG No data
1025819318_1025819328 3 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819328 7:64947683-64947705 ACACCCTGTGTGGGGGCGGAGGG No data
1025819318_1025819324 -4 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819324 7:64947676-64947698 ACGCTCCACACCCTGTGTGGGGG No data
1025819318_1025819321 -7 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819321 7:64947673-64947695 GGGACGCTCCACACCCTGTGTGG No data
1025819318_1025819337 25 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819337 7:64947705-64947727 GGACGCGGTGGGTGCGGCCTGGG No data
1025819318_1025819338 30 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819338 7:64947710-64947732 CGGTGGGTGCGGCCTGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025819318 Original CRISPR GCGTCCCGACCGGGCGTCAG CGG (reversed) Intergenic
No off target data available for this crispr