ID: 1025819320

View in Genome Browser
Species Human (GRCh38)
Location 7:64947667-64947689
Sequence AGGGTGTGGAGCGTCCCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025819320_1025819340 24 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819340 7:64947714-64947736 GGGTGCGGCCTGGGCGCGGGTGG No data
1025819320_1025819332 0 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG No data
1025819320_1025819329 -6 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819320_1025819333 3 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819333 7:64947693-64947715 TGGGGGCGGAGGGGACGCGGTGG No data
1025819320_1025819338 20 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819338 7:64947710-64947732 CGGTGGGTGCGGCCTGGGCGCGG No data
1025819320_1025819339 21 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819339 7:64947711-64947733 GGTGGGTGCGGCCTGGGCGCGGG No data
1025819320_1025819336 14 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819336 7:64947704-64947726 GGGACGCGGTGGGTGCGGCCTGG No data
1025819320_1025819327 -8 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819327 7:64947682-64947704 CACACCCTGTGTGGGGGCGGAGG No data
1025819320_1025819341 25 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819341 7:64947715-64947737 GGTGCGGCCTGGGCGCGGGTGGG No data
1025819320_1025819334 4 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819334 7:64947694-64947716 GGGGGCGGAGGGGACGCGGTGGG No data
1025819320_1025819335 9 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819335 7:64947699-64947721 CGGAGGGGACGCGGTGGGTGCGG No data
1025819320_1025819328 -7 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819328 7:64947683-64947705 ACACCCTGTGTGGGGGCGGAGGG No data
1025819320_1025819337 15 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819337 7:64947705-64947727 GGACGCGGTGGGTGCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025819320 Original CRISPR AGGGTGTGGAGCGTCCCGAC CGG (reversed) Intergenic
No off target data available for this crispr