ID: 1025819329

View in Genome Browser
Species Human (GRCh38)
Location 7:64947684-64947706
Sequence CACCCTGTGTGGGGGCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025819319_1025819329 -5 Left 1025819319 7:64947666-64947688 CCCGGTCGGGACGCTCCACACCC No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819320_1025819329 -6 Left 1025819320 7:64947667-64947689 CCGGTCGGGACGCTCCACACCCT No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819314_1025819329 9 Left 1025819314 7:64947652-64947674 CCTGCCCGCTGACGCCCGGTCGG No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819311_1025819329 27 Left 1025819311 7:64947634-64947656 CCACAGGAGCTGCATGGCCCTGC No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819317_1025819329 5 Left 1025819317 7:64947656-64947678 CCCGCTGACGCCCGGTCGGGACG No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819318_1025819329 4 Left 1025819318 7:64947657-64947679 CCGCTGACGCCCGGTCGGGACGC No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data
1025819313_1025819329 10 Left 1025819313 7:64947651-64947673 CCCTGCCCGCTGACGCCCGGTCG No data
Right 1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025819329 Original CRISPR CACCCTGTGTGGGGGCGGAG GGG Intergenic
No off target data available for this crispr