ID: 1025823542

View in Genome Browser
Species Human (GRCh38)
Location 7:64993250-64993272
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 13, 2: 21, 3: 33, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025823540_1025823542 -5 Left 1025823540 7:64993232-64993254 CCGTGTGTGGACTGGTCAGCTTC 0: 1
1: 5
2: 24
3: 102
4: 175
Right 1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG 0: 2
1: 13
2: 21
3: 33
4: 128
1025823537_1025823542 8 Left 1025823537 7:64993219-64993241 CCTCAAGCTTCAGCCGTGTGTGG 0: 1
1: 4
2: 18
3: 58
4: 151
Right 1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG 0: 2
1: 13
2: 21
3: 33
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900119634 1:1042975-1042997 GCTTCCTGATTGTCCACAGCAGG - Intronic
900289607 1:1918352-1918374 GCTTCCGGAGGCAGCAGAACCGG + Exonic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
904470315 1:30731973-30731995 TCTTCCCCAGTGTCCAGAGCAGG + Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
907123987 1:52033187-52033209 GAATCCGGAGTCACAAGAGCTGG + Exonic
907249057 1:53125836-53125858 GCTTCTGGTGTAAACAGAGCTGG - Intronic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
917981426 1:180271998-180272020 GCTTCCGAGGTGAGCAGGGCTGG + Exonic
923095578 1:230772885-230772907 ACTTCCCAAGGGACCAGAGCTGG - Intronic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1069559026 10:69416684-69416706 ACTTCCTGAGTGACCTGGGCTGG - Exonic
1070670643 10:78375085-78375107 GGTTCCTGAGTCACCAGGGCTGG - Intergenic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1074892093 10:117744203-117744225 GCTTCCAGAGTGGTCAGAGAGGG + Intergenic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1087895010 11:103577223-103577245 GCTTCCGGTGTGACTGAAGCAGG - Intergenic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1091999741 12:5022441-5022463 GCTACTGGAGTGACCACAGAAGG - Intergenic
1092245721 12:6863278-6863300 TCATCCGGAGTGACCAGGGGTGG - Exonic
1092654896 12:10673972-10673994 GAAACCGGAGTGACCAGAGGAGG - Exonic
1096042059 12:48526194-48526216 GCTTCTGGAGATATCAGAGCAGG - Exonic
1096771798 12:53939886-53939908 GCTACCGGACAGAGCAGAGCCGG - Intronic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1104746898 12:131216237-131216259 GCTTCAGGGGTGAGCACAGCTGG - Intergenic
1104952935 12:132450592-132450614 GCTTGCGGGGTGAGCTGAGCCGG + Intergenic
1106914720 13:34500135-34500157 ACAGCAGGAGTGACCAGAGCTGG - Intergenic
1110862400 13:80357591-80357613 GCTTCCCCACTGAACAGAGCAGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1123028368 14:105439188-105439210 GCTGCCTGAGTGACCAGGGAGGG - Intronic
1123028387 14:105439267-105439289 GCTGCCTGAGTGACCAGGGAGGG - Intronic
1123218934 14:106839144-106839166 GCTTCCGAAGTAAGCAGAGCCGG + Intergenic
1125403683 15:39331318-39331340 GCTTCCAGAGTGACCATTTCAGG - Intergenic
1125502972 15:40251037-40251059 GCTTCCTGGGTGACCACAGGAGG + Exonic
1126908421 15:53392388-53392410 GCTTCCGGAAGGCACAGAGCTGG - Intergenic
1128335559 15:66783715-66783737 GCTTCTGGGCTGACCACAGCTGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1132592559 16:732518-732540 GCTTCAGGAGTGACCGGGCCTGG - Intronic
1132927181 16:2436890-2436912 GCTTCCGGGAGGACCACAGCAGG + Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1142590204 17:1001381-1001403 GCTTCAGGCCTGACCACAGCTGG + Exonic
1142614003 17:1124697-1124719 CCTTCCAGAGTGAACAGAGGAGG + Intronic
1143148034 17:4789320-4789342 GCTCCAGGAGGGACCAGAACAGG + Intronic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1150543406 17:66127722-66127744 GCTTCCTGAGAGTCAAGAGCTGG - Intronic
1152320825 17:79608219-79608241 CCTTCCGCAGGGACCAGAGGCGG - Intergenic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1156493432 18:37510448-37510470 GCTTCCTTAGTGACCCCAGCAGG + Intronic
1160299622 18:77668305-77668327 GCTCCCGGGGTGCCCAGTGCTGG - Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1160817622 19:1043386-1043408 GCTTCAGGCGTCTCCAGAGCAGG - Exonic
1161083134 19:2321378-2321400 GGTTCAGGAGTGACCAAGGCGGG - Intronic
1161231810 19:3178420-3178442 GCTTCGGGGGTGATCAGGGCTGG + Intronic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1165279261 19:34782705-34782727 TCTTCCCTAGTGACCTGAGCTGG - Intergenic
1165918026 19:39273009-39273031 GCTTCAGGCGTCAGCAGAGCGGG - Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
930316010 2:49797766-49797788 TCTTCCAGAGTGCCCAGAACTGG - Intergenic
933812516 2:86041799-86041821 TCTTCCGGAGTGAGTAGGGCAGG + Intronic
934759784 2:96848159-96848181 GCTTCCACAGTGACCAGACTGGG + Exonic
934921438 2:98347653-98347675 GCTTCCGGCGAGGCCTGAGCCGG - Intronic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
936056185 2:109264007-109264029 GCTTCTGGAGTGTCCTGACCAGG - Intronic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
940865323 2:158812140-158812162 GCTTTTGGGGTGCCCAGAGCAGG - Intronic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1171951019 20:31422389-31422411 ACTTTCTCAGTGACCAGAGCTGG - Intergenic
1172301825 20:33855769-33855791 GCTTCTGGGTTCACCAGAGCTGG - Intergenic
1172655054 20:36531775-36531797 GTTTCCGGAGTCAGCAGAGAAGG + Intergenic
1172802292 20:37584671-37584693 GCTTCCGGAATGACCAGGATGGG + Intergenic
1173792101 20:45834293-45834315 GTTTCCGGAGAGCTCAGAGCTGG + Exonic
1174452897 20:50630746-50630768 GCTTCAGCAGTGCACAGAGCCGG - Exonic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1184485555 22:44776689-44776711 CCTCCCGGAGTGCCCAGTGCTGG - Intronic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
1185047831 22:48537795-48537817 CCTGCCGGAGTGAAGAGAGCAGG + Intronic
950674402 3:14545871-14545893 GTTTCAGCAGTGAACAGAGCAGG + Intergenic
952401889 3:32970797-32970819 GCTTCCAGTGTGGTCAGAGCAGG - Intergenic
953051725 3:39350243-39350265 GCTTCCGGTGTGGTCAGAGCAGG - Intergenic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
957616179 3:82530445-82530467 TTTTCCAGAGTGACCAGGGCTGG + Intergenic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976539 4:68901154-68901176 GCTCCCAGTGTGACTAGAGCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
977043365 4:92041001-92041023 GTTCCGGGTGTGACCAGAGCAGG + Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
986285078 5:6353389-6353411 GCTCCCGGAGCACCCAGAGCTGG + Intergenic
997855227 5:137367274-137367296 GCTTACGGAGAGTCCAGACCAGG - Intronic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
998401058 5:141849443-141849465 GCTTTCGGAGAGACCCGAGTTGG - Intergenic
1001492812 5:172167766-172167788 GCTACCGTATTGAACAGAGCAGG + Intronic
1001795995 5:174502882-174502904 GCTTCCCTAGTACCCAGAGCAGG - Intergenic
1003115459 6:3280977-3280999 GCTGCCGGAGTGGGCAGGGCAGG + Intronic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006339878 6:33440975-33440997 GCTTCAGGAGTGGGCAGGGCAGG + Intronic
1007730539 6:43942808-43942830 GCTTCCGGAGGGTCCTGGGCAGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1015539482 6:134299498-134299520 GCTTCCTGAGAGATCAGAGGTGG + Intronic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1018737419 6:166697859-166697881 GCTACAGAAGTGAGCAGAGCAGG - Intronic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032571506 7:133004554-133004576 GCTTTCTGAGAGGCCAGAGCAGG + Intronic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1034489826 7:151387265-151387287 GCTTGCTGGGTGACCAGGGCAGG + Intronic
1035317332 7:158004346-158004368 GCTTCCTGTGTGTCCACAGCTGG + Intronic
1035412573 7:158656910-158656932 GCTTCTTCAGTGTCCAGAGCTGG - Intronic
1036643891 8:10600532-10600554 GCTTCCGTGGTGACCAGGGGCGG + Intergenic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1040545176 8:48393372-48393394 GCTTCCCGTGTGCCCAGAACTGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041527368 8:58822483-58822505 ACAGCAGGAGTGACCAGAGCCGG + Intronic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1056588300 9:87943950-87943972 GCTTCGGGAGGGCCCAGATCAGG + Intergenic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061221991 9:129257637-129257659 GCTTCCCCAGGGCCCAGAGCAGG - Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062578269 9:137218449-137218471 GCTCCCGCAGGGTCCAGAGCCGG - Intergenic
1186210868 X:7249336-7249358 GCTTCAGGAGCAACCAGTGCAGG + Intronic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1195218198 X:102721220-102721242 GCTTCAGGGGAGCCCAGAGCGGG + Intronic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic