ID: 1025827108

View in Genome Browser
Species Human (GRCh38)
Location 7:65019435-65019457
Sequence CTCAAACTCTCCCAAGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025827108_1025827112 0 Left 1025827108 7:65019435-65019457 CCACCTACTTGGGAGAGTTTGAG No data
Right 1025827112 7:65019458-65019480 GCAGGAGAATCACTCAACCCAGG No data
1025827108_1025827113 3 Left 1025827108 7:65019435-65019457 CCACCTACTTGGGAGAGTTTGAG No data
Right 1025827113 7:65019461-65019483 GGAGAATCACTCAACCCAGGAGG No data
1025827108_1025827114 6 Left 1025827108 7:65019435-65019457 CCACCTACTTGGGAGAGTTTGAG No data
Right 1025827114 7:65019464-65019486 GAATCACTCAACCCAGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025827108 Original CRISPR CTCAAACTCTCCCAAGTAGG TGG (reversed) Intergenic
No off target data available for this crispr