ID: 1025827114

View in Genome Browser
Species Human (GRCh38)
Location 7:65019464-65019486
Sequence GAATCACTCAACCCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025827107_1025827114 7 Left 1025827107 7:65019434-65019456 CCCACCTACTTGGGAGAGTTTGA No data
Right 1025827114 7:65019464-65019486 GAATCACTCAACCCAGGAGGCGG No data
1025827106_1025827114 15 Left 1025827106 7:65019426-65019448 CCTGTAATCCCACCTACTTGGGA 0: 616
1: 51861
2: 147455
3: 249911
4: 548023
Right 1025827114 7:65019464-65019486 GAATCACTCAACCCAGGAGGCGG No data
1025827110_1025827114 3 Left 1025827110 7:65019438-65019460 CCTACTTGGGAGAGTTTGAGGCA No data
Right 1025827114 7:65019464-65019486 GAATCACTCAACCCAGGAGGCGG No data
1025827108_1025827114 6 Left 1025827108 7:65019435-65019457 CCACCTACTTGGGAGAGTTTGAG No data
Right 1025827114 7:65019464-65019486 GAATCACTCAACCCAGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025827114 Original CRISPR GAATCACTCAACCCAGGAGG CGG Intergenic
No off target data available for this crispr