ID: 1025844594

View in Genome Browser
Species Human (GRCh38)
Location 7:65184997-65185019
Sequence TTTTCCAGTGACTGGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025844594_1025844604 29 Left 1025844594 7:65184997-65185019 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025844604 7:65185049-65185071 ACCAATAGTGGTTCAGCTCTTGG No data
1025844594_1025844600 0 Left 1025844594 7:65184997-65185019 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025844600 7:65185020-65185042 TGGGAATGGGATTGCCATGATGG No data
1025844594_1025844606 30 Left 1025844594 7:65184997-65185019 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025844606 7:65185050-65185072 CCAATAGTGGTTCAGCTCTTGGG No data
1025844594_1025844603 17 Left 1025844594 7:65184997-65185019 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025844603 7:65185037-65185059 TGATGGGTTTAGACCAATAGTGG No data
1025844594_1025844601 1 Left 1025844594 7:65184997-65185019 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025844601 7:65185021-65185043 GGGAATGGGATTGCCATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025844594 Original CRISPR TTTTCCAGTGACTGGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr