ID: 1025850294

View in Genome Browser
Species Human (GRCh38)
Location 7:65238941-65238963
Sequence GGCAACCCCCATCCTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025850294_1025850300 -5 Left 1025850294 7:65238941-65238963 CCTTGCCCAGGATGGGGGTTGCC No data
Right 1025850300 7:65238959-65238981 TTGCCTGTTTCCAGGGGAACAGG No data
1025850294_1025850304 17 Left 1025850294 7:65238941-65238963 CCTTGCCCAGGATGGGGGTTGCC No data
Right 1025850304 7:65238981-65239003 GCTCTTGGCAGTCGCCCTCCAGG No data
1025850294_1025850302 2 Left 1025850294 7:65238941-65238963 CCTTGCCCAGGATGGGGGTTGCC No data
Right 1025850302 7:65238966-65238988 TTTCCAGGGGAACAGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025850294 Original CRISPR GGCAACCCCCATCCTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr