ID: 1025850417

View in Genome Browser
Species Human (GRCh38)
Location 7:65239451-65239473
Sequence GTCTGTGGACACCACGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025850409_1025850417 4 Left 1025850409 7:65239424-65239446 CCTCTGGCTTTGGGGCCTAGGGG No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data
1025850406_1025850417 8 Left 1025850406 7:65239420-65239442 CCAGCCTCTGGCTTTGGGGCCTA No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data
1025850400_1025850417 19 Left 1025850400 7:65239409-65239431 CCCTCCAAATTCCAGCCTCTGGC No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data
1025850402_1025850417 15 Left 1025850402 7:65239413-65239435 CCAAATTCCAGCCTCTGGCTTTG No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data
1025850398_1025850417 22 Left 1025850398 7:65239406-65239428 CCACCCTCCAAATTCCAGCCTCT No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data
1025850401_1025850417 18 Left 1025850401 7:65239410-65239432 CCTCCAAATTCCAGCCTCTGGCT No data
Right 1025850417 7:65239451-65239473 GTCTGTGGACACCACGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025850417 Original CRISPR GTCTGTGGACACCACGGGCC AGG Intergenic
No off target data available for this crispr