ID: 1025858609

View in Genome Browser
Species Human (GRCh38)
Location 7:65305948-65305970
Sequence GACACCTCTGTCAATATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025858608_1025858609 -7 Left 1025858608 7:65305932-65305954 CCTTACTGAACTTTTTGACACCT No data
Right 1025858609 7:65305948-65305970 GACACCTCTGTCAATATAGTTGG No data
1025858607_1025858609 -3 Left 1025858607 7:65305928-65305950 CCGGCCTTACTGAACTTTTTGAC No data
Right 1025858609 7:65305948-65305970 GACACCTCTGTCAATATAGTTGG No data
1025858605_1025858609 6 Left 1025858605 7:65305919-65305941 CCACAACACCCGGCCTTACTGAA No data
Right 1025858609 7:65305948-65305970 GACACCTCTGTCAATATAGTTGG No data
1025858606_1025858609 -2 Left 1025858606 7:65305927-65305949 CCCGGCCTTACTGAACTTTTTGA No data
Right 1025858609 7:65305948-65305970 GACACCTCTGTCAATATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025858609 Original CRISPR GACACCTCTGTCAATATAGT TGG Intergenic
No off target data available for this crispr