ID: 1025866113

View in Genome Browser
Species Human (GRCh38)
Location 7:65382741-65382763
Sequence AAGTGTTACCTGCACATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 7, 3: 25, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025866113_1025866117 13 Left 1025866113 7:65382741-65382763 CCACAAATGTGCAGGTAACACTT 0: 1
1: 1
2: 7
3: 25
4: 211
Right 1025866117 7:65382777-65382799 CCATCCAGGACCTAAACTAGCGG No data
1025866113_1025866114 -1 Left 1025866113 7:65382741-65382763 CCACAAATGTGCAGGTAACACTT 0: 1
1: 1
2: 7
3: 25
4: 211
Right 1025866114 7:65382763-65382785 TACTGCTATTCTACCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025866113 Original CRISPR AAGTGTTACCTGCACATTTG TGG (reversed) Intronic
902454938 1:16526524-16526546 ATGAGGTAGCTGCACATTTGGGG - Intergenic
902497228 1:16881371-16881393 ATGAGGTAGCTGCACATTTGGGG + Intronic
904553618 1:31342574-31342596 TATTGTGACCTGCACATGTGAGG - Intronic
905962549 1:42056495-42056517 AAGTGCTTCATGCACAATTGTGG + Intergenic
906660031 1:47575403-47575425 AAGTGTTGCATATACATTTGTGG + Intergenic
908696618 1:66849483-66849505 AATTGAAACCTGGACATTTGGGG - Intronic
912909743 1:113745695-113745717 CACTGTGACCTGCACATTCGAGG + Intronic
915269542 1:154743781-154743803 AAGTGTTCCCAGCACGTTTAAGG + Intronic
918096041 1:181334995-181335017 AAGTGTGCCCAGCACATGTGAGG - Intergenic
919326912 1:196119633-196119655 AAATTTTATCTGAACATTTGAGG - Intergenic
919501814 1:198346842-198346864 AACTGTCACCTGGACATTTTGGG + Intergenic
920250826 1:204621200-204621222 AGGTCTTACCTGCACAGCTGAGG - Exonic
921502688 1:215925173-215925195 AAGTGTTACCTTTACTTTTTTGG - Intronic
923181260 1:231522013-231522035 AAATGTCACCTTCTCATTTGAGG - Intergenic
924350301 1:243108080-243108102 AACTGTTGGCTGCACATCTGGGG - Intergenic
924905674 1:248449578-248449600 ATCTGTTATCTGCACACTTGGGG - Intergenic
924922217 1:248642458-248642480 ATCTGTTATCTGCACACTTGGGG + Intergenic
1062956728 10:1545360-1545382 CAGTGTGATCTGAACATTTGGGG + Intronic
1063281194 10:4631386-4631408 AGGTGAGACCTGCACATGTGAGG + Intergenic
1066975095 10:42360884-42360906 AGGTGTTAACTGCACATTTATGG + Intergenic
1070372622 10:75798182-75798204 AAGTGTTCCTTGCATTTTTGTGG + Intronic
1071075523 10:81746760-81746782 AAGTTTTGCATGCACATTTGCGG - Intergenic
1072332709 10:94369337-94369359 AACTGTGAACTGCACATTTGAGG - Intergenic
1073722850 10:106193763-106193785 AAGGTTTACCTGTAAATTTGTGG - Intergenic
1074356670 10:112791859-112791881 AAGTGTTTCCCTCACATTTTAGG - Intronic
1075907258 10:126092455-126092477 AATTGTTTGCTGGACATTTGGGG - Intronic
1077055879 11:592886-592908 ATGTATTACCTGCACTTCTGTGG - Intronic
1077907905 11:6547955-6547977 AAGTGTTCCCTGCACTTATCTGG - Exonic
1078503666 11:11910837-11910859 AATTGAAACCTGGACATTTGGGG - Intronic
1079830416 11:25259626-25259648 CGGTGTTGCCTGCAAATTTGGGG - Intergenic
1081626973 11:44661943-44661965 ATGTGTTATCTGCACATCTGTGG + Intergenic
1084433317 11:69123445-69123467 CAGAGTTCCCTGCACCTTTGAGG + Intergenic
1087844683 11:102959858-102959880 AAGTGTTCCGTGCACATTTAAGG - Intergenic
1088385335 11:109248035-109248057 CAGTATTACCTGCAGTTTTGGGG + Intergenic
1088657291 11:112012955-112012977 AAATGTTATGTACACATTTGGGG - Intronic
1089036398 11:115397919-115397941 AAGTCTTCCCTGAATATTTGGGG + Intronic
1093327954 12:17802919-17802941 AGCTGTTACCTGCACTTCTGTGG - Intergenic
1095841324 12:46696796-46696818 ATGTGTCACCTCCACATTTAGGG - Intergenic
1095876454 12:47084166-47084188 AAGTGTTCTGTGCACATTTAAGG - Intronic
1096591275 12:52660728-52660750 AAATGTTACCTACCCTTTTGTGG + Intergenic
1097955076 12:65476190-65476212 AAGTGGCAGCTGCACACTTGAGG + Intronic
1099494105 12:83323716-83323738 AAGTGGTACTTGCACATGAGTGG - Intergenic
1101322467 12:103684881-103684903 AGGTGATAACTGCAAATTTGGGG - Intronic
1101342296 12:103853649-103853671 AACTCTTCACTGCACATTTGTGG + Intergenic
1101428286 12:104605740-104605762 AGGTGTCAACTGCATATTTGTGG + Intronic
1101457586 12:104852473-104852495 AAGTTTTACCAACAAATTTGTGG - Intronic
1104962583 12:132495281-132495303 AAGTGTGACCTGGCCATGTGGGG + Intronic
1105230510 13:18490880-18490902 AGGTGTTAACTGCACATTTTTGG + Intergenic
1106811639 13:33364123-33364145 AAGTGTAAACTGTAGATTTGGGG - Intergenic
1107586513 13:41854980-41855002 AAATGTTAGTTGCACAGTTGAGG + Intronic
1109448085 13:62471467-62471489 AAGACTACCCTGCACATTTGGGG + Intergenic
1109673927 13:65647963-65647985 GATTGTAACCTGCACATTTTGGG + Intergenic
1111049257 13:82857743-82857765 CAGTGTCAGATGCACATTTGAGG - Intergenic
1113601653 13:111573647-111573669 CAGTGTTTCCTGTACGTTTGCGG - Intergenic
1113978305 13:114249208-114249230 TATTGTTAACTGCACATGTGAGG - Intronic
1114014770 14:18417692-18417714 AGGTGTTAACTACACATTTATGG + Intergenic
1115794788 14:36922556-36922578 AATTGTTGGCTGCACACTTGTGG + Intronic
1116661087 14:47711064-47711086 GAGTGTTGCCTGCATATTTTGGG + Intergenic
1117722544 14:58641734-58641756 AATTCTTACCTGCAGATTTGGGG - Exonic
1118676059 14:68185757-68185779 TATTGTGAACTGCACATTTGAGG - Intronic
1119014401 14:71035269-71035291 AAGTTTTACTTTCACATATGGGG - Intronic
1119627700 14:76195055-76195077 AAGTGTTCCTTGAACATTTGGGG - Intronic
1120293897 14:82614116-82614138 AAGTGTTCTGAGCACATTTGAGG + Intergenic
1120511433 14:85420844-85420866 AGGTGTTTCATGCATATTTGTGG - Intergenic
1122163827 14:99806190-99806212 GATAATTACCTGCACATTTGAGG + Intronic
1123716327 15:23035526-23035548 CATTGTGAACTGCACATTTGAGG - Intronic
1124073345 15:26416190-26416212 AGGTGTGACATGCACATTTTTGG + Intergenic
1125433032 15:39616523-39616545 AAGGGGTACCTGAACATTTCTGG + Intronic
1126673100 15:51134371-51134393 AACTGTTATCTGGACCTTTGTGG + Intergenic
1126978834 15:54218224-54218246 ATGTGTTGCCAGCACATGTGTGG - Intronic
1127275486 15:57439588-57439610 TAGTGTTACCTGAGTATTTGAGG - Exonic
1129082113 15:73051478-73051500 ACGTTTTACCTGTACCTTTGCGG - Intergenic
1130359886 15:83173361-83173383 AAGTGTTCTCAGCACATTTAAGG + Intronic
1130371431 15:83288144-83288166 AAGGTTTACCTGCCCATTTGCGG - Intergenic
1132214815 15:100054653-100054675 AAGTGTGACCACCACATCTGTGG - Intronic
1133510472 16:6452568-6452590 AAGTGATACCTGAACAATAGGGG + Intronic
1133895766 16:9927400-9927422 AGGTGTTACCAGCAAACTTGAGG + Intronic
1137037953 16:35582648-35582670 AGGGGTTATCTGCACATTTGTGG + Intergenic
1138841601 16:60515467-60515489 AAGTGTTCCCTGGATATTTGGGG - Intergenic
1140898132 16:79343432-79343454 AAGGGTTATCTGCACAGATGTGG - Intergenic
1141056703 16:80823021-80823043 TATTGTAAACTGCACATTTGAGG + Intergenic
1144152961 17:12468589-12468611 AAGTGTTGCCTGGAAATTAGTGG - Intergenic
1146496961 17:33331117-33331139 TATTGTGAACTGCACATTTGAGG + Intronic
1148227541 17:45909347-45909369 AAGTGTTCTCTGCACATTGTGGG - Intronic
1150467930 17:65410670-65410692 TATTGTGAACTGCACATTTGAGG - Intergenic
1150469418 17:65424164-65424186 TACTGTTATCTGCACACTTGGGG + Intergenic
1153945167 18:10011508-10011530 AAGCCTTAGCTTCACATTTGTGG - Intergenic
1154522894 18:15248988-15249010 AGGTGTTAACTGCACATTTATGG - Intergenic
1155744885 18:29342579-29342601 CATTGATATCTGCACATTTGAGG - Intergenic
1157084702 18:44567776-44567798 AAGTGTTCTGAGCACATTTGAGG + Intergenic
1158953722 18:62521666-62521688 AACTGTTTTCAGCACATTTGAGG - Intergenic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG + Intergenic
1163936041 19:20444839-20444861 AGGTTTTACCTGCACATTTGTGG - Intergenic
1163970239 19:20786489-20786511 AGGTATTACCTGTACGTTTGTGG - Intronic
1164022055 19:21316510-21316532 AGGTATTACTTGCACATTTGTGG + Intronic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1164139861 19:22449619-22449641 AGGTGTTATTTGCATATTTGTGG - Intronic
1164140675 19:22459221-22459243 AGGTGGTACCTGCACATTTGTGG - Intronic
1164175775 19:22772860-22772882 AGGTGTTCCCTGCACATCTGTGG + Intronic
1164183624 19:22841815-22841837 AGGTGTTACTTGCATATTTGTGG - Intergenic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
1164744549 19:30601517-30601539 AAGTGTTACATGCAATTTAGGGG - Intronic
1166214804 19:41327921-41327943 AAGTGCTGGCTGCACATTCGCGG - Intronic
925595040 2:5547259-5547281 AAGTGTTTCCTGATCATTTGAGG + Intergenic
925779856 2:7372221-7372243 AAGACCCACCTGCACATTTGCGG - Intergenic
927765512 2:25803700-25803722 TATTGTGAACTGCACATTTGAGG - Intronic
930102967 2:47617422-47617444 TGGTGTTGCCTGCACATTTGAGG - Intergenic
933399934 2:81783129-81783151 CATTGATACCTGCAAATTTGAGG + Intergenic
935908469 2:107866833-107866855 AAGTATTATCTCCACATTTCAGG - Intronic
938522183 2:132081835-132081857 AGGTGTTAACTGCACATTTATGG - Intergenic
939987959 2:148850699-148850721 AAGTGTTGCCTGCATTTTGGAGG + Intergenic
943716159 2:191154476-191154498 AAGTGTTACCTGCAGATCCCTGG - Intergenic
944395826 2:199264902-199264924 AAGTGTTACCTTCACATATGGGG - Intergenic
944464087 2:199982892-199982914 ACATATTACCTGCACATTAGGGG - Intronic
944887164 2:204074973-204074995 AAGTGTTACTTCAACTTTTGAGG - Intergenic
946576153 2:221077714-221077736 AAGTGTTACATGCCCATGTAGGG - Intergenic
948034304 2:234845714-234845736 AAGTGTTCTGTGCACATTTAAGG - Intergenic
1169017476 20:2303674-2303696 AAGTAGTGCCTGCACATATGGGG + Intronic
1169500909 20:6159511-6159533 AAGTGTTCCGGGCACATTTAAGG + Intergenic
1171328341 20:24315853-24315875 AAGTGTTCTCAGCACATTTAAGG - Intergenic
1174318804 20:49724368-49724390 AAGTGTTCCGAGCACATTTAAGG + Intergenic
1175576096 20:60061806-60061828 AAATGTTAACTGCACAAATGAGG - Intronic
1175662424 20:60825326-60825348 AAGTCTTACCTGTACATGAGGGG + Intergenic
1175695013 20:61096149-61096171 TATTGTGAGCTGCACATTTGAGG - Intergenic
1176774501 21:13119227-13119249 AGGTGTTAACTGCACATTTATGG + Intergenic
1176945279 21:14972811-14972833 TAGTGTAAACTGCACATGTGAGG - Intronic
1177615973 21:23520426-23520448 AATTGTTGCCTGAACTTTTGGGG + Intergenic
1179320219 21:40284337-40284359 AAATATTACCTGCACAGTGGTGG - Intronic
1179502148 21:41816555-41816577 CCGTGTTCCCTCCACATTTGGGG + Intronic
1180439270 22:15348468-15348490 AGGTGTTAACTACACATTTATGG + Intergenic
1180522123 22:16218943-16218965 AGGTATTAACTGCACATTTATGG + Intergenic
1181908029 22:26215274-26215296 AGGTGTTACATGCACAATGGTGG + Intronic
1182976673 22:34628693-34628715 AAGTATGACCTGCACATTCCCGG + Intergenic
1185311964 22:50161210-50161232 CACTGTTTCCTGGACATTTGGGG + Intronic
949241254 3:1875093-1875115 AATTATTAACTGTACATTTGAGG - Intergenic
951281690 3:20758129-20758151 AAGTGTCACCTGCAAACTTAAGG - Intergenic
951553609 3:23898926-23898948 AATTGTGAACTGCACATGTGAGG + Intronic
951649471 3:24934305-24934327 AAGAGTTACCGGCACATCTCAGG + Intergenic
953320968 3:41971172-41971194 CAGTGTTTGCTGCACATTTGGGG - Intergenic
953859771 3:46533548-46533570 AAGTGTTCTCAGCACATTTAAGG - Intronic
956896246 3:73663264-73663286 GTGTGTCACCTGCACATTTATGG + Intergenic
957598932 3:82306626-82306648 TGTTGTTGCCTGCACATTTGAGG - Intergenic
958726486 3:97911491-97911513 AACTGTAAGCTGCACATTTAAGG + Intronic
961429991 3:126874705-126874727 ATCTGTTACCTGGACCTTTGTGG + Intronic
962053228 3:131841516-131841538 AACTGTGAACTGCACATGTGAGG + Intronic
964125966 3:153233756-153233778 AAGTTTCAACTGCACATTTGAGG - Intergenic
964489593 3:157221569-157221591 AAGTGATACATGCTCATTTTAGG + Intergenic
966177187 3:177151465-177151487 TATTGTGAACTGCACATTTGAGG + Intronic
966702419 3:182869852-182869874 ACTTGTTAGCTGGACATTTGGGG - Intronic
967795403 3:193593482-193593504 GAGAGTCACCTGCACATTTTTGG - Intronic
968859025 4:3151602-3151624 TATTGTGAACTGCACATTTGAGG + Intronic
969998475 4:11339600-11339622 AAGTGCCACCTGCTCATCTGTGG - Intergenic
970802700 4:19993574-19993596 AAGTGGTCCCTTCACACTTGAGG - Intergenic
973804111 4:54508892-54508914 GAGTCTGACCTGCACTTTTGTGG - Intergenic
979251634 4:118572474-118572496 AACTGTTGGCTGCACATCTGGGG + Intergenic
979254594 4:118597758-118597780 AAGTGTTACCTACACCCTCGGGG - Intergenic
979301854 4:119095502-119095524 AAATGTTACCTGAACACTAGTGG + Intergenic
979666260 4:123314263-123314285 CAGTTTTACCTGGAAATTTGTGG + Exonic
982464398 4:155712482-155712504 AAGGTTTACTTGCACATGTGTGG - Intronic
983009145 4:162523559-162523581 AAGTGTGAGCTACACAGTTGTGG - Intergenic
984711724 4:182890875-182890897 AAGTGTTTGCTGCAGAGTTGAGG - Exonic
986851788 5:11821412-11821434 AATTGTTACCTGCACAATCTAGG + Intronic
988777078 5:34486814-34486836 AAGTGTTCTCAGCACGTTTGTGG - Intergenic
990980163 5:61595189-61595211 AAATGTTATCTGCATAGTTGGGG - Intergenic
992078476 5:73213490-73213512 AATTGTTCCTAGCACATTTGAGG + Intergenic
992285204 5:75227886-75227908 TACTGTTAACTGCACATGTGAGG + Intronic
993811276 5:92479897-92479919 GAGTGTTACATGTACACTTGAGG - Intergenic
993968531 5:94388170-94388192 TATTGTGAACTGCACATTTGAGG - Intronic
995804229 5:116033407-116033429 AAGTGTTCTCAGAACATTTGAGG + Intronic
995939361 5:117561116-117561138 CAGTGTGACTTGCAAATTTGTGG - Intergenic
996650740 5:125873217-125873239 AAGTGTTATCAGCTCATTAGAGG + Intergenic
997307938 5:132853689-132853711 AAGTGTCAACTGTACATTTTGGG - Intergenic
997754334 5:136381923-136381945 AAGTGTTCTCAGCACATTTAAGG - Intronic
1004620617 6:17327280-17327302 AAGAGTTACAGGCAGATTTGGGG + Intergenic
1005269190 6:24145409-24145431 AAGTGTTTCCTGCAAATTTGGGG + Intronic
1005638956 6:27776580-27776602 AATTGTAAACTGCCCATTTGAGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008255763 6:49297725-49297747 AAGTGTTAACAGCACAGTGGAGG + Intergenic
1008826180 6:55697121-55697143 AAGTGTTGCCTTCACAATAGAGG - Intergenic
1010028560 6:71247509-71247531 TTTTGATACCTGCACATTTGAGG - Intergenic
1011500469 6:87982648-87982670 CATTGGTATCTGCACATTTGAGG - Intergenic
1011557461 6:88585862-88585884 AAGTGCTACATGCACCTGTGTGG + Intergenic
1014388580 6:120832253-120832275 AAATGTTACATACAAATTTGTGG + Intergenic
1015376388 6:132514743-132514765 GAATGTTATCTGCACACTTGTGG + Intergenic
1015987440 6:138898555-138898577 AAGTGTGGCCTGCAGATCTGTGG + Intronic
1016548926 6:145255377-145255399 AAGTGTTAACAGCTCATTGGAGG + Intergenic
1018656927 6:166046018-166046040 AAAAGAAACCTGCACATTTGAGG - Intergenic
1019518327 7:1449266-1449288 AAGTGTGGCCGGCACACTTGAGG + Intronic
1021040121 7:15851329-15851351 AATTGTGAACTGCACATGTGAGG + Intergenic
1021478180 7:21086323-21086345 AACTGTGAACTGCACATGTGAGG + Intergenic
1023675518 7:42625474-42625496 AATTGCTACCTTCACATTTTTGG + Intergenic
1023912013 7:44563026-44563048 GAGGGATCCCTGCACATTTGAGG - Intergenic
1025161646 7:56666540-56666562 AAGTGAAGCCAGCACATTTGTGG + Intergenic
1025745841 7:64241957-64241979 AAGTGAAGCCAGCACATTTGTGG - Intronic
1025774742 7:64550508-64550530 AGGTGTCACCTGCAGATTTATGG + Intronic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1026266925 7:68803355-68803377 AAATGTTACCTGCAGCTTTAAGG - Intergenic
1027514899 7:79129171-79129193 AAGTGTTCTGAGCACATTTGAGG - Intronic
1027650116 7:80856149-80856171 AATTTTTACCTGCATATTTATGG - Intronic
1027692923 7:81370530-81370552 TAGTGTTACCTACACATTCATGG + Intergenic
1029034416 7:97503718-97503740 TATTGTGAACTGCACATTTGAGG + Intergenic
1029239225 7:99146808-99146830 AAGTGTTCTGTGCACATTTAAGG - Intergenic
1030412272 7:109196324-109196346 AAGTGTTATCAGCACATTTAAGG - Intergenic
1031171403 7:118296513-118296535 AAGGGTTAGCTTCACATTGGTGG - Intergenic
1035734314 8:1876737-1876759 ACGTGTTCCCTGCACATGTGAGG + Intronic
1037164439 8:15810122-15810144 AAGTATCACCTGCAGACTTGGGG + Intergenic
1037771907 8:21806404-21806426 AAGTGTTCTCGGCACATTTAAGG + Intronic
1038193159 8:25342640-25342662 AAGTGTTAGCTGCAGAAATGGGG - Intronic
1038516400 8:28191203-28191225 AACTGAAACCTGCACATTTGTGG - Intergenic
1038898785 8:31818566-31818588 TATTGTGAACTGCACATTTGAGG - Intronic
1042351515 8:67782046-67782068 AACTGTTACATGAATATTTGCGG + Intergenic
1042566787 8:70119517-70119539 AAGGGATACCTGCACTCTTGTGG - Intronic
1043252642 8:78094720-78094742 AATTGTTACTTTCTCATTTGAGG + Intergenic
1043289897 8:78584734-78584756 AAGTGTTTTCTGCACAATTCAGG - Intronic
1045078149 8:98593603-98593625 TATTGTGACCTGCACATGTGAGG + Intronic
1045616332 8:103917198-103917220 AATTATTACATGCAGATTTGGGG + Intronic
1047378736 8:124334010-124334032 GAGTTTTCCCTGCACATGTGTGG - Intronic
1048632876 8:136263131-136263153 AAGTGTTCTGAGCACATTTGAGG - Intergenic
1049132650 8:140861529-140861551 AAGTGTGAGCTGCACATTATGGG - Intronic
1049549200 8:143248922-143248944 ATGTGTTACCTGCACTCATGAGG + Intronic
1051263884 9:15292342-15292364 ATGAGTTACCTACATATTTGTGG + Intronic
1052230714 9:26148068-26148090 AAGTGATATTTACACATTTGGGG - Intergenic
1053700874 9:40688969-40688991 AGGTGTTAACTGCACATTCATGG - Intergenic
1054312167 9:63488367-63488389 AGGTGTTAACTGCACATTCATGG - Intergenic
1054410941 9:64812425-64812447 AGGTGTTAACTGCACATTCATGG - Intergenic
1054750638 9:68902121-68902143 CAGTTTTACATGCACATGTGTGG + Intronic
1056290604 9:85139980-85140002 CAGTGTTTCCTGCTTATTTGTGG - Intergenic
1185935579 X:4253510-4253532 AAGTGTGTCCTGCACATAGGAGG + Intergenic
1186192971 X:7084096-7084118 AGCTGTTACCTGCATCTTTGCGG + Intronic
1186517397 X:10176197-10176219 CAGAGCTACCAGCACATTTGCGG - Intronic
1186629639 X:11335198-11335220 AAGGAATACCTGCCCATTTGGGG - Intronic
1187429860 X:19211958-19211980 AAGTGTTTCCTGCAGAGATGCGG - Intergenic
1188251551 X:27901867-27901889 TTTTGTTACCTGCACTTTTGAGG - Intergenic
1192868194 X:75158623-75158645 AAGTGTTTCTTCCACATTTCAGG - Intergenic
1194304386 X:92224647-92224669 AAATGTTGCCTGCCCACTTGTGG + Intronic
1194324039 X:92488939-92488961 AAGTGACACCTGCAGCTTTGTGG + Intronic
1195455030 X:105058490-105058512 ACATGTTACCTGAACATATGTGG + Intronic
1196002587 X:110802651-110802673 AAATGTTAGATGCAGATTTGGGG + Intergenic
1200632142 Y:5602032-5602054 AAGTGACACCTGCAGCTTTGTGG + Intronic
1201589833 Y:15602990-15603012 TATTGTTACCTGCAAATATGAGG + Intergenic
1201719300 Y:17079239-17079261 AAGTGTGTCCTGCACAGTGGAGG + Intergenic
1201719810 Y:17084174-17084196 AAGTGTGTCCTGCACAGATGAGG - Intergenic