ID: 1025871083

View in Genome Browser
Species Human (GRCh38)
Location 7:65434876-65434898
Sequence TCGGAGCCACTAGTGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025871083_1025871087 6 Left 1025871083 7:65434876-65434898 CCTTTCTACACTAGTGGCTCCGA No data
Right 1025871087 7:65434905-65434927 TCTGCTTAATGTCTACCAGTAGG No data
1025871083_1025871088 7 Left 1025871083 7:65434876-65434898 CCTTTCTACACTAGTGGCTCCGA No data
Right 1025871088 7:65434906-65434928 CTGCTTAATGTCTACCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025871083 Original CRISPR TCGGAGCCACTAGTGTAGAA AGG (reversed) Intergenic
No off target data available for this crispr