ID: 1025879505

View in Genome Browser
Species Human (GRCh38)
Location 7:65521367-65521389
Sequence ACATGGACACTGCAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025879495_1025879505 19 Left 1025879495 7:65521325-65521347 CCGCATGTTCTCACTCATAAGTG 0: 3248
1: 13349
2: 16364
3: 6922
4: 3560
Right 1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG No data
1025879494_1025879505 26 Left 1025879494 7:65521318-65521340 CCAAACACCGCATGTTCTCACTC 0: 6871
1: 18600
2: 11708
3: 8808
4: 7951
Right 1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025879505 Original CRISPR ACATGGACACTGCAGGTGGG GGG Intergenic
No off target data available for this crispr