ID: 1025893933

View in Genome Browser
Species Human (GRCh38)
Location 7:65681221-65681243
Sequence ACATGGACACTGCAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025893933_1025893944 26 Left 1025893933 7:65681221-65681243 CCCCCCACCTGCAGTGTCCATGT No data
Right 1025893944 7:65681270-65681292 GAGTGAGAACATGCGGTGTTTGG 0: 6871
1: 18600
2: 11708
3: 8808
4: 7951
1025893933_1025893943 19 Left 1025893933 7:65681221-65681243 CCCCCCACCTGCAGTGTCCATGT No data
Right 1025893943 7:65681263-65681285 CACTTATGAGTGAGAACATGCGG 0: 3248
1: 13349
2: 16364
3: 6922
4: 3560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025893933 Original CRISPR ACATGGACACTGCAGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr