ID: 1025894922

View in Genome Browser
Species Human (GRCh38)
Location 7:65691335-65691357
Sequence TTTTCCAGTGACTGGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025894922_1025894930 1 Left 1025894922 7:65691335-65691357 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025894930 7:65691359-65691381 GGGAATGGGGTTGCCATGATGGG No data
1025894922_1025894933 29 Left 1025894922 7:65691335-65691357 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025894933 7:65691387-65691409 ACCAATAGTGGTTCAGCTCTTGG No data
1025894922_1025894929 0 Left 1025894922 7:65691335-65691357 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025894929 7:65691358-65691380 TGGGAATGGGGTTGCCATGATGG No data
1025894922_1025894932 17 Left 1025894922 7:65691335-65691357 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025894932 7:65691375-65691397 TGATGGGTTTAGACCAATAGTGG No data
1025894922_1025894935 30 Left 1025894922 7:65691335-65691357 CCAGCAAACCAGTCACTGGAAAA No data
Right 1025894935 7:65691388-65691410 CCAATAGTGGTTCAGCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025894922 Original CRISPR TTTTCCAGTGACTGGTTTGC TGG (reversed) Intergenic
No off target data available for this crispr