ID: 1025896088

View in Genome Browser
Species Human (GRCh38)
Location 7:65702604-65702626
Sequence GTATGAGTTTGGTGGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025896088_1025896096 27 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896096 7:65702654-65702676 GTCTTGGCTTTCATTGTGCTGGG No data
1025896088_1025896093 5 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896093 7:65702632-65702654 AGTTGGGCTTAGCTAGTCTATGG No data
1025896088_1025896094 11 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896094 7:65702638-65702660 GCTTAGCTAGTCTATGGTCTTGG No data
1025896088_1025896095 26 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896095 7:65702653-65702675 GGTCTTGGCTTTCATTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025896088 Original CRISPR GTATGAGTTTGGTGGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr