ID: 1025896094

View in Genome Browser
Species Human (GRCh38)
Location 7:65702638-65702660
Sequence GCTTAGCTAGTCTATGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025896088_1025896094 11 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896094 7:65702638-65702660 GCTTAGCTAGTCTATGGTCTTGG No data
1025896089_1025896094 3 Left 1025896089 7:65702612-65702634 CCACCAAACTCATACTTCACAGT No data
Right 1025896094 7:65702638-65702660 GCTTAGCTAGTCTATGGTCTTGG No data
1025896090_1025896094 0 Left 1025896090 7:65702615-65702637 CCAAACTCATACTTCACAGTTGG No data
Right 1025896094 7:65702638-65702660 GCTTAGCTAGTCTATGGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025896094 Original CRISPR GCTTAGCTAGTCTATGGTCT TGG Intergenic
No off target data available for this crispr