ID: 1025896096

View in Genome Browser
Species Human (GRCh38)
Location 7:65702654-65702676
Sequence GTCTTGGCTTTCATTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025896088_1025896096 27 Left 1025896088 7:65702604-65702626 CCATCTGGCCACCAAACTCATAC No data
Right 1025896096 7:65702654-65702676 GTCTTGGCTTTCATTGTGCTGGG No data
1025896089_1025896096 19 Left 1025896089 7:65702612-65702634 CCACCAAACTCATACTTCACAGT No data
Right 1025896096 7:65702654-65702676 GTCTTGGCTTTCATTGTGCTGGG No data
1025896090_1025896096 16 Left 1025896090 7:65702615-65702637 CCAAACTCATACTTCACAGTTGG No data
Right 1025896096 7:65702654-65702676 GTCTTGGCTTTCATTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025896096 Original CRISPR GTCTTGGCTTTCATTGTGCT GGG Intergenic
No off target data available for this crispr