ID: 1025901972

View in Genome Browser
Species Human (GRCh38)
Location 7:65751704-65751726
Sequence AGGACTTTTCCCAGATCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025901972_1025901974 -4 Left 1025901972 7:65751704-65751726 CCCTGAGATCTGGGAAAAGTCCT No data
Right 1025901974 7:65751723-65751745 TCCTTTTTTGTTGTTTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025901972 Original CRISPR AGGACTTTTCCCAGATCTCA GGG (reversed) Intergenic
No off target data available for this crispr