ID: 1025908466

View in Genome Browser
Species Human (GRCh38)
Location 7:65808455-65808477
Sequence GGTGCTGCTGAGCACCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025908466_1025908471 10 Left 1025908466 7:65808455-65808477 CCTGCACGGTGCTCAGCAGCACC No data
Right 1025908471 7:65808488-65808510 CAGTTTCTCTGAACCTGCATGGG No data
1025908466_1025908470 9 Left 1025908466 7:65808455-65808477 CCTGCACGGTGCTCAGCAGCACC No data
Right 1025908470 7:65808487-65808509 GCAGTTTCTCTGAACCTGCATGG No data
1025908466_1025908472 13 Left 1025908466 7:65808455-65808477 CCTGCACGGTGCTCAGCAGCACC No data
Right 1025908472 7:65808491-65808513 TTTCTCTGAACCTGCATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025908466 Original CRISPR GGTGCTGCTGAGCACCGTGC AGG (reversed) Intergenic
No off target data available for this crispr