ID: 1025910337

View in Genome Browser
Species Human (GRCh38)
Location 7:65823736-65823758
Sequence CTCAGGCTGCAGCACAGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025910332_1025910337 29 Left 1025910332 7:65823684-65823706 CCACATCTTCGCTGACTTTTTTT No data
Right 1025910337 7:65823736-65823758 CTCAGGCTGCAGCACAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025910337 Original CRISPR CTCAGGCTGCAGCACAGTGA CGG Intergenic