ID: 1025912744

View in Genome Browser
Species Human (GRCh38)
Location 7:65841021-65841043
Sequence GCCACAGTGAGGCATGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025912744_1025912749 5 Left 1025912744 7:65841021-65841043 CCACGCTCATGCCTCACTGTGGC No data
Right 1025912749 7:65841049-65841071 CAGGCCTAGCTTTCGCTTTTTGG No data
1025912744_1025912751 15 Left 1025912744 7:65841021-65841043 CCACGCTCATGCCTCACTGTGGC No data
Right 1025912751 7:65841059-65841081 TTTCGCTTTTTGGCCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025912744 Original CRISPR GCCACAGTGAGGCATGAGCG TGG (reversed) Intergenic
No off target data available for this crispr