ID: 1025919259

View in Genome Browser
Species Human (GRCh38)
Location 7:65895220-65895242
Sequence CATTATAAGCACAAGTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025919258_1025919259 -4 Left 1025919258 7:65895201-65895223 CCTTACATAACTTTACTTTCATT 0: 1
1: 0
2: 1
3: 30
4: 433
Right 1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG 0: 1
1: 0
2: 1
3: 14
4: 160
1025919257_1025919259 4 Left 1025919257 7:65895193-65895215 CCAACTTACCTTACATAACTTTA 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025919259 Original CRISPR CATTATAAGCACAAGTTAGA TGG Intronic
901792081 1:11658963-11658985 CATTGGAAGCACAGGTGAGAAGG - Intronic
903402141 1:23062002-23062024 AATTATAAGCATAAATTAGTGGG - Intronic
903508370 1:23854189-23854211 CATTATAAACAAAATTTAGGAGG - Intronic
904165038 1:28548954-28548976 CGTCATAAACACAATTTAGATGG - Intergenic
905883390 1:41478789-41478811 TATTATAAACACAAGTTCGCAGG + Exonic
907217735 1:52880144-52880166 CATTCTTAGCACAACTGAGAGGG - Intronic
908378236 1:63568199-63568221 TATTAGAAGGACAAGCTAGAAGG + Intronic
908474768 1:64476739-64476761 CATAATAAGCACAAGGAATAAGG - Intronic
911666169 1:100555393-100555415 CATGATAATCACAAAATAGAAGG - Intergenic
911686452 1:100782208-100782230 CAATTTAAGCAGAATTTAGAAGG - Intergenic
911970213 1:104425230-104425252 CATTATAAGCAGCAGTAAAAAGG - Intergenic
912021478 1:105112612-105112634 CATTAGAAGGACAATTTGGAAGG + Intergenic
912598392 1:110902699-110902721 AATTATAAACAAAAGATAGAAGG + Intergenic
913464766 1:119128741-119128763 CATTTTGACCACAAGTTAGAAGG - Intronic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916406725 1:164505248-164505270 TATTATTATCACAAGTTAGAAGG + Intergenic
917445615 1:175103924-175103946 CATTGGAAGGACAATTTAGAAGG - Intronic
919801267 1:201356033-201356055 CATCATAAGCACAAGAATGATGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
921744696 1:218726225-218726247 CATTCAAAGCATAAGATAGAGGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
1063968839 10:11367394-11367416 CATTAAAAGCACCAGTTTGGTGG - Intergenic
1065037989 10:21660123-21660145 AATTATAAGAAAAAATTAGATGG - Intronic
1066588893 10:36970562-36970584 CAATATAAGCACCAATCAGATGG - Intergenic
1067202088 10:44181884-44181906 CATTTTAAGCCAATGTTAGATGG - Intergenic
1068628019 10:59270395-59270417 CATTATTTGCATAAGTCAGAGGG + Intronic
1069057323 10:63857840-63857862 CATTATAAACACAACTTCTAGGG - Intergenic
1073365843 10:102940358-102940380 CATAATAAGCACAAATAAGAGGG - Intronic
1073964081 10:108968168-108968190 CATTCTAACCACAACTTAGTTGG - Intergenic
1077746429 11:4911941-4911963 GCTTATAAGCAGAAGTTAGTTGG - Intronic
1087874133 11:103335741-103335763 CATCATAAACACAGGTTAAAAGG - Intronic
1093180281 12:15959408-15959430 AAATATAAGTACAATTTAGAGGG - Intronic
1093443307 12:19225622-19225644 CATTATAAGGTGATGTTAGAGGG + Intronic
1093580411 12:20779714-20779736 CATTAGAAGGACAATTTGGAAGG - Intergenic
1094720142 12:33054928-33054950 AATGAAAAGAACAAGTTAGAAGG + Intergenic
1095792555 12:46183475-46183497 AATTATGAGCACAAATTTGAAGG - Intronic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1097954201 12:65466680-65466702 CATTTTAAACACAAGTAATACGG - Exonic
1098179352 12:67829534-67829556 CATTATAAGAACAGATTTGAGGG - Intergenic
1098884198 12:75943515-75943537 CATTATAAACAAAATTTAGGAGG - Intergenic
1099381893 12:81964706-81964728 CAATATAACCAGAAGTGAGATGG + Intergenic
1100172405 12:91990403-91990425 CATAATAAACACATGTTAGAAGG + Intronic
1101485394 12:105152862-105152884 CATTATATGCACAAGTAAAATGG - Intronic
1102413246 12:112738540-112738562 CATTTTGAGCAGAATTTAGATGG + Intronic
1108436489 13:50406106-50406128 CATTATCATCACATGGTAGAGGG - Intronic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1110605336 13:77425740-77425762 CTTTATAAGCAGAAGTCAGGAGG + Intergenic
1119343065 14:73897258-73897280 CAATAGATACACAAGTTAGAAGG + Intronic
1120461994 14:84809029-84809051 CATTAGAACCAGAAGTCAGAAGG + Intergenic
1124615637 15:31239916-31239938 TATTCCAAGCACAAGTTACATGG + Intergenic
1127357476 15:58214404-58214426 CATTATAAGCAACAGCTAGATGG + Intronic
1127708523 15:61571373-61571395 AATTATAAGTACAAATTAGATGG - Intergenic
1137604050 16:49775538-49775560 CATTATAAGGACAAGTGAGAGGG - Intronic
1137999371 16:53258910-53258932 CATCTGAAGCACAATTTAGATGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145804285 17:27715364-27715386 CATTGGAAGGACAAGTCAGATGG + Intergenic
1148976908 17:51537697-51537719 TGTTATACTCACAAGTTAGATGG + Intergenic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1151085178 17:71372201-71372223 CATTAAAGGCACAGGCTAGAGGG + Intergenic
1152442608 17:80318164-80318186 CTTTATAGGCACAAGATAGGGGG + Intronic
1154962349 18:21322112-21322134 TATTATAAGCAGAATTCAGAAGG + Intronic
1155023243 18:21915643-21915665 AATGATGAGGACAAGTTAGAAGG - Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1161790483 19:6356596-6356618 CATTATAAACAAAATTTAGGAGG - Intergenic
1163661567 19:18581017-18581039 CATTAGAAGGACAATTTGGAGGG + Intronic
1166558711 19:43718339-43718361 CATTTTTGGCACAAGTTAGAGGG - Intronic
925256932 2:2498434-2498456 CATAATAAGCACCAGTTGGGTGG + Intergenic
925401017 2:3573116-3573138 GATCATAATCACAACTTAGAGGG - Intergenic
925422398 2:3723628-3723650 CTTTGTAAACACAAGTCAGAAGG - Intronic
925800545 2:7595191-7595213 GCATATAAGCACAAGGTAGAGGG + Intergenic
925854400 2:8116051-8116073 AATTAAAAGCACAAGTTTGTGGG - Intergenic
926438899 2:12866702-12866724 GATTATAAACCCAGGTTAGAAGG - Intergenic
926674479 2:15609242-15609264 GATTATAGACAAAAGTTAGAGGG + Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
930504068 2:52259443-52259465 TATTTGAAACACAAGTTAGATGG - Intergenic
933328586 2:80869244-80869266 CATTTTAAGAGGAAGTTAGAAGG + Intergenic
933739368 2:85521242-85521264 CATTATAAACAAAATTTAGGAGG + Intergenic
935619762 2:105118568-105118590 CATTTTAAGCACAAGTTCAGTGG - Intergenic
936547464 2:113404889-113404911 CATTTTAAGCAAACTTTAGAGGG + Intergenic
937646320 2:124269549-124269571 CATGATAAGCACCAGGGAGAGGG + Intronic
941180740 2:162256182-162256204 CTATATAATCACAAGGTAGAGGG + Intergenic
941356999 2:164505973-164505995 AACTTTAAGCCCAAGTTAGAAGG + Intronic
943981574 2:194559380-194559402 CATTATAATCAGAAGTTTGTAGG + Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944431303 2:199636462-199636484 TTTTAGAAGCACAACTTAGAAGG + Intergenic
945433270 2:209790619-209790641 GATTATAAGCATATGTCAGAGGG + Intronic
947029716 2:225780188-225780210 CCTTATAAGAAAAAGTCAGAAGG - Intergenic
949064019 2:241978757-241978779 CAATGTGAGCACAAGTCAGAAGG - Intergenic
1172747825 20:37226642-37226664 CAAAGTAAGCACAAGTTAAAAGG - Intronic
1173673504 20:44814105-44814127 CATTCTAAGAACAAGTTTGGGGG + Intergenic
1176668883 21:9713474-9713496 CATTAGAAATAGAAGTTAGATGG + Intergenic
1177081167 21:16640352-16640374 AGATATGAGCACAAGTTAGAGGG - Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1178563677 21:33663364-33663386 AATTATAAGCTTTAGTTAGATGG + Intronic
1179589455 21:42396861-42396883 CATTATAAAAACAAGTGTGATGG + Intergenic
1184637795 22:45848936-45848958 CATCATAAGACCAAGTCAGAGGG + Intergenic
1185022764 22:48389673-48389695 CGTTAGAAGCACGAGATAGAAGG + Intergenic
949180822 3:1129261-1129283 TATTTTAAGTGCAAGTTAGAGGG + Intronic
950584469 3:13882459-13882481 CATTATATTCACAAGTTATAGGG - Intergenic
952472085 3:33665958-33665980 GATTATAAACACAATTTAGGAGG + Intronic
952773874 3:37026062-37026084 CATGAAAAGCCAAAGTTAGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957574358 3:81989113-81989135 CATTCCAAGCAAAAGTTAAAAGG - Intergenic
959134382 3:102398769-102398791 CTTTAAAAACACAAGTTTGAAGG + Intronic
959478569 3:106842656-106842678 AATTATAAGTAAAAGTAAGAAGG - Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964291170 3:155182386-155182408 CATTAAAGGCTCAAGTAAGATGG - Exonic
964869762 3:161300658-161300680 CAGTAGAAGCACAGGTTACAGGG - Intergenic
965095094 3:164216034-164216056 CGTTATAAGAAAAAGTTATAGGG - Intergenic
967772655 3:193351914-193351936 CATTATTAGCATGAGTTAGCAGG - Intronic
969099691 4:4759635-4759657 CATTTTAAGCAAACGTTCGAGGG - Intergenic
970454335 4:16207160-16207182 CATTATGAGAAGAATTTAGAGGG + Intronic
973046025 4:45535027-45535049 CATTGGAAGGACAATTTAGAAGG + Intergenic
973149267 4:46866888-46866910 AATTATATGAACAAGTTACATGG + Intronic
973664911 4:53149311-53149333 AATGATAAGCACAAGTCAAAAGG + Intronic
975912848 4:79289220-79289242 CTTTATAATCACAACTGAGAGGG - Intronic
982641433 4:157966643-157966665 CCTGATGAGCAAAAGTTAGATGG + Intergenic
983418420 4:167487385-167487407 CATTCTAAGCTCAAGGTAAAAGG - Intergenic
983698058 4:170556965-170556987 AATTTTAAACTCAAGTTAGAAGG - Intergenic
983728168 4:170956840-170956862 CTTTATAAGCAAAATTCAGAAGG - Intergenic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
984450913 4:179900138-179900160 GATTATAGGCACAAGACAGAAGG - Intergenic
985405900 4:189638039-189638061 CATTAGAAATAGAAGTTAGATGG - Intergenic
986216383 5:5723209-5723231 AATTCTATGCACAAGTTAGCTGG - Intergenic
987160976 5:15142108-15142130 CATAATAAGCAAAAGTTGGGTGG - Intergenic
987579372 5:19769581-19769603 CCTTATAAGCAAAAGTTAACTGG + Intronic
991038059 5:62147910-62147932 AATTATAAGCACAAAATCGAAGG - Intergenic
991062017 5:62386287-62386309 AATTATAATCACATGTTATATGG - Intronic
991169788 5:63609136-63609158 TTTTATAAGCAAAAATTAGAAGG - Intergenic
991562400 5:67967736-67967758 CTTTATAAGTACAAGTTTTAGGG - Intergenic
993162541 5:84311444-84311466 CATTATAAACAAAATTTAGGAGG + Intronic
995081579 5:108056770-108056792 CAATTTAAGCACATCTTAGATGG + Intronic
995533134 5:113110590-113110612 CATTTAAAGCACAAGGTAAAGGG + Intronic
998537559 5:142948669-142948691 CATTAAAAACAGAGGTTAGAAGG + Intronic
999681590 5:154065295-154065317 CATTCTAAGAACAAATTAAATGG + Intronic
1000487708 5:161868850-161868872 GATTATAATCACAGGTTTGAAGG - Intronic
1000862550 5:166474126-166474148 CATTAAAAGCAAAAGTGAGCAGG + Intergenic
1005679202 6:28188891-28188913 CTTAATAAACACAAGTTAGGAGG + Intergenic
1008159264 6:48057490-48057512 CATTTATAACACAAGTTAGATGG + Intronic
1009581245 6:65536552-65536574 CATTAAAACCAGAAGTTTGAAGG - Intronic
1010643947 6:78364648-78364670 CTTTATAGGCACAGGTTAGGGGG - Intergenic
1014948188 6:127521123-127521145 TATTATAAGCAAACATTAGAAGG - Intronic
1017032837 6:150239206-150239228 CAATATACGTACAAGTTACATGG + Intronic
1017415962 6:154220985-154221007 CATTAAAAGAACATGTTAAAAGG - Intronic
1021365790 7:19776152-19776174 TATTATAAGCAAAATTTATATGG + Intergenic
1022502173 7:30888595-30888617 GATTACAAGGACAAGTAAGAAGG - Intronic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1028720559 7:94026157-94026179 CATTATCAGCAAATGTTACATGG - Intergenic
1029016974 7:97325423-97325445 AATTATAAGAAAAAGTTAAATGG + Intergenic
1032666062 7:134037636-134037658 CATTTTAGGCACAATTTAGAAGG + Intronic
1034997392 7:155586866-155586888 CTTTTCAAGCACAAGCTAGAAGG - Intergenic
1036576140 8:10029364-10029386 CATCCTAAGCCCAAGTGAGAGGG - Intergenic
1043146684 8:76665516-76665538 CTTTATACGCACAATTTACACGG + Intergenic
1044230200 8:89766151-89766173 TGTTACAAGCACAACTTAGACGG - Intronic
1046470945 8:114673039-114673061 CAACATAAGCACAAGACAGATGG - Intergenic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1059462326 9:114440966-114440988 CATTATAAGAAAAAGTTGCATGG + Intronic
1062505343 9:136871613-136871635 CATCAGAAGCACATGTTATATGG - Intronic
1203656983 Un_KI270753v1:7461-7483 CATTAGAAATAGAAGTTAGATGG - Intergenic
1185954728 X:4477240-4477262 CATTATAATCACAGGTTTGAAGG + Intergenic
1185954931 X:4478783-4478805 CATTATAATCACAGGTTTGAAGG - Intergenic
1186721691 X:12311164-12311186 CAGTAGATGCACAAGATAGATGG - Intronic
1187371264 X:18708724-18708746 CATCATCAGCACAAGTCAGCTGG - Intronic
1188213083 X:27446333-27446355 CATCATATGAACAAGTTATATGG - Intergenic
1188825105 X:34821914-34821936 CATTGACAGCAGAAGTTAGAAGG + Intergenic
1189972089 X:46428282-46428304 CATTATAAGGAAAGGTTAAAAGG - Intergenic
1191677477 X:63806834-63806856 CATTAAAAGAATAAGTTAGTAGG + Intergenic
1195878513 X:109568105-109568127 AATTACAAGCACAAGTCTGACGG + Intergenic
1196671460 X:118372722-118372744 GATTAGAAGCACAAGTGAGAAGG + Intronic
1196890156 X:120283696-120283718 CATTTTAAGAGCAATTTAGAAGG - Intronic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197833528 X:130670988-130671010 CATTATCAGCACAAGCTTGCAGG + Intronic
1198879884 X:141268578-141268600 AATTATATGCAAAATTTAGAAGG + Intergenic
1201330188 Y:12810728-12810750 CATTGTAAGCATAATTGAGAAGG - Exonic