ID: 1025926359

View in Genome Browser
Species Human (GRCh38)
Location 7:65963421-65963443
Sequence AACTGAAGATAGCAGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 309}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025926359_1025926365 30 Left 1025926359 7:65963421-65963443 CCACCAAACTGCTATCTTCAGTT 0: 1
1: 0
2: 1
3: 27
4: 309
Right 1025926365 7:65963474-65963496 GGACACATTCATTGCGAACTTGG 0: 1
1: 0
2: 8
3: 8
4: 114
1025926359_1025926362 8 Left 1025926359 7:65963421-65963443 CCACCAAACTGCTATCTTCAGTT 0: 1
1: 0
2: 1
3: 27
4: 309
Right 1025926362 7:65963452-65963474 GTCCATAAACTAAGAAGAAATGG 0: 9
1: 1
2: 2
3: 23
4: 358
1025926359_1025926363 9 Left 1025926359 7:65963421-65963443 CCACCAAACTGCTATCTTCAGTT 0: 1
1: 0
2: 1
3: 27
4: 309
Right 1025926363 7:65963453-65963475 TCCATAAACTAAGAAGAAATGGG 0: 9
1: 1
2: 3
3: 32
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025926359 Original CRISPR AACTGAAGATAGCAGTTTGG TGG (reversed) Intronic
902127304 1:14226473-14226495 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
902763371 1:18598924-18598946 TTTTGAAGCTAGCAGTTTGGTGG - Intergenic
905311630 1:37052954-37052976 AACTGAAGACAACACTTGGGTGG + Intergenic
906844597 1:49177977-49177999 AACTGAAGATGACAGTTAGAGGG + Intronic
906942435 1:50267169-50267191 ATCTGAAGACAGCATGTTGGAGG + Intergenic
907768153 1:57431661-57431683 AGCTAAAGAGAGCAGATTGGTGG - Intronic
909432326 1:75603551-75603573 CACTGTGGAAAGCAGTTTGGAGG - Intronic
909616689 1:77618013-77618035 CACTGTGGATAACAGTTTGGTGG - Intronic
909848677 1:80433147-80433169 AATTCAAAATAGCAGTTTTGAGG - Intergenic
909903348 1:81165856-81165878 CACTATAGATAACAGTTTGGAGG + Intergenic
910036648 1:82796951-82796973 AAATGAGGACAGCAGTTTGCTGG + Intergenic
910159837 1:84260900-84260922 AACTGGAGAGATCAGTGTGGAGG + Intergenic
910469945 1:87541109-87541131 CACTATAGAGAGCAGTTTGGAGG - Intergenic
910922518 1:92364446-92364468 AGCTGAAGATACCATTTTGGGGG - Intronic
911075064 1:93865193-93865215 AATTGAATATAGCAGTATGTAGG + Intergenic
911209022 1:95120136-95120158 AGAAGAAGATAGCAGTATGGAGG + Intronic
913061392 1:115211518-115211540 AGCTGTAGATAGTAGTTTTGTGG - Intergenic
914387252 1:147181832-147181854 AAATGAAGACAGCAGGTTGATGG + Intronic
915930298 1:160056497-160056519 AAGGGAAGACAGCAGTCTGGAGG - Intronic
916287144 1:163120665-163120687 CACTGTGGAAAGCAGTTTGGAGG + Intronic
916513710 1:165496330-165496352 GCCTGAAGGAAGCAGTTTGGGGG - Intergenic
917077395 1:171219622-171219644 AACTGAACACAGCAGTAAGGTGG + Intergenic
918250870 1:182702007-182702029 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
918892526 1:190294551-190294573 AACTGAAAATAGCTGTTTTGAGG - Intronic
919067928 1:192715763-192715785 AATTGAAAATAGCTGTTTTGAGG + Intergenic
919257399 1:195141929-195141951 AATTCAAGATAGCTGTTTTGAGG - Intergenic
919375410 1:196787319-196787341 AACTGAACATTGTAGTTTAGAGG + Intronic
919787011 1:201264714-201264736 TACAGAAGATAGCTGCTTGGAGG - Intergenic
920104069 1:203538115-203538137 AACTGTAGAGAGCAGATGGGTGG + Intergenic
922139529 1:222869495-222869517 AACTAAAGATATTAATTTGGTGG - Intergenic
1063645263 10:7875022-7875044 AATTATAGATAGCAGTTTGTAGG + Intronic
1063856148 10:10256503-10256525 AACTGATGAAAGTACTTTGGAGG - Intergenic
1063958586 10:11287235-11287257 AACTGAAGATAGAAAGATGGTGG - Intronic
1064921328 10:20522230-20522252 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1064924454 10:20554896-20554918 AACTGAAAACAGCAATTTGATGG - Intergenic
1064946803 10:20799499-20799521 AAATGAAGATAGCACTTTTTTGG + Intronic
1066290574 10:34010937-34010959 GCATGAAGATAGCAGTTAGGAGG + Intergenic
1068194186 10:53694880-53694902 AACTGAAGATATCACATTGTAGG - Intergenic
1068562745 10:58534190-58534212 TACCCAAGATAGCAGATTGGAGG + Intronic
1072367825 10:94732393-94732415 TACTGTGGAAAGCAGTTTGGAGG + Intronic
1073405721 10:103295698-103295720 AACTGAAGATTGAAGTTAGAGGG + Intergenic
1073999393 10:109353977-109353999 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1074629389 10:115234227-115234249 AACTGAAGATATCAGTTTCATGG - Intronic
1075868933 10:125753809-125753831 AGTTGAAGATAGCAGTTTAATGG - Exonic
1076740843 10:132483776-132483798 AGCTGTGGACAGCAGTTTGGTGG + Intergenic
1078100278 11:8326267-8326289 TCCTGAAGACAGCAGTTTGTTGG + Intergenic
1078787429 11:14508705-14508727 AATTGCAGATAGCTTTTTGGAGG - Intronic
1079597176 11:22264323-22264345 AACTTAAAATAAAAGTTTGGGGG - Intronic
1080351969 11:31395464-31395486 TACTGTGGAAAGCAGTTTGGTGG - Intronic
1081242840 11:40728217-40728239 CCCTGTAGAAAGCAGTTTGGAGG + Intronic
1082884558 11:58068789-58068811 CACTCCAGAGAGCAGTTTGGTGG + Intronic
1083827737 11:65212665-65212687 AGCTCAAGATAGCAGTGTGCGGG - Intergenic
1084655663 11:70515960-70515982 AACTGAAGAAACCAGTATGCAGG - Intronic
1084894002 11:72251996-72252018 CACTGAAGACATCACTTTGGAGG - Intergenic
1085911793 11:80835408-80835430 AATTGAAACTAGCAGTTTCGAGG + Intergenic
1086128436 11:83374723-83374745 AACTATAGAGAACAGTTTGGAGG - Intergenic
1086797207 11:91121422-91121444 AACAATAGAAAGCAGTTTGGTGG - Intergenic
1086943886 11:92825974-92825996 AACTGGACATAGTAGTTTAGAGG - Intronic
1087602009 11:100328788-100328810 ACCTGAAGATGGCAGATAGGTGG + Intronic
1088046939 11:105464371-105464393 CACTAAAGAAAACAGTTTGGAGG + Intergenic
1088154683 11:106789417-106789439 AACTGAAAATTGCTGTTTTGAGG - Intronic
1089872361 11:121686905-121686927 AACTGTGGAAAGCAGTTTGGAGG - Intergenic
1089897467 11:121945744-121945766 AACTAAAGATTGCAATTTGTTGG - Intergenic
1089917675 11:122174536-122174558 AGCTAGAGATGGCAGTTTGGTGG - Intergenic
1090339240 11:126001463-126001485 AACTCAAGAAAGGAGTTTTGTGG - Intronic
1092477960 12:8835233-8835255 AACTGGAGATAACACTTTAGAGG + Intronic
1092650371 12:10628370-10628392 AAGAGAAGAGAGAAGTTTGGTGG + Intronic
1092798511 12:12139101-12139123 AACTGAATAAAGCAGGGTGGGGG - Intronic
1093344257 12:18021566-18021588 AACTGTGGAAAGCAGTTTAGAGG + Intergenic
1094157623 12:27353989-27354011 CACTGTGGAAAGCAGTTTGGAGG + Intronic
1094328425 12:29266086-29266108 CACTACAGATAACAGTTTGGAGG + Intronic
1095132316 12:38558839-38558861 AAATGATGGTAGCAGTTTGTAGG - Intergenic
1095598796 12:43991833-43991855 AAACGGAGAGAGCAGTTTGGAGG - Intronic
1096305928 12:50475566-50475588 AACTGAAGATGGCTCTTTAGGGG - Exonic
1098333623 12:69380027-69380049 AACTCAAAATAGCTGTTTTGAGG - Intronic
1099495507 12:83341035-83341057 AACTCAAAATAGCTGTTTTGAGG + Intergenic
1100880345 12:99009446-99009468 AACTGAAGAAGGAAGTCTGGGGG - Intronic
1101226816 12:102695576-102695598 AACTCAAAATAGCTGTTTTGAGG + Intergenic
1101426918 12:104595613-104595635 AAGTGAAGATCTTAGTTTGGTGG + Intronic
1101789139 12:107912030-107912052 AGCTGGAGACAGCATTTTGGGGG + Intergenic
1102596933 12:114000021-114000043 AGCAGAAGATGGCAATTTGGTGG + Intergenic
1104011348 12:124932612-124932634 AACTTAAGATAACTGTTTTGGGG + Intergenic
1106338247 13:28804218-28804240 CACTGAAGAAAACAGTGTGGAGG - Intergenic
1109621068 13:64906006-64906028 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1110095606 13:71515974-71515996 AACTTAAGAAAGAAGTTAGGAGG + Intronic
1110663748 13:78090968-78090990 AACTACAGAGAACAGTTTGGAGG + Intergenic
1110687208 13:78389020-78389042 AACTGAAGGGAGAAGTTTAGGGG + Intergenic
1111260756 13:85737321-85737343 CACTAAAGAAAGCAGTTTGGAGG + Intergenic
1112053517 13:95669189-95669211 AATTCAAAATAGCTGTTTGGAGG - Intergenic
1112088674 13:96058034-96058056 AACTGCAGAAAACAGTATGGTGG - Intergenic
1112706104 13:102070452-102070474 CACTGTAGAGAACAGTTTGGAGG + Intronic
1113197769 13:107829170-107829192 ATGTGAAGAAAGCACTTTGGAGG + Intronic
1115090543 14:29568859-29568881 CAATGAAGAAAGCAATTTGGAGG + Intergenic
1115295770 14:31825163-31825185 CACTGTGGAAAGCAGTTTGGTGG - Intronic
1117867416 14:60164610-60164632 AACTAAAAATGGCAGTTTGCTGG - Intronic
1117949964 14:61072948-61072970 CACTGTAGAGAACAGTTTGGAGG - Intronic
1118794124 14:69124540-69124562 CACTTAAGACATCAGTTTGGTGG - Intronic
1120237664 14:81911299-81911321 TACTGTGGAGAGCAGTTTGGAGG - Intergenic
1121856095 14:97271468-97271490 AACTGGGGATGGCTGTTTGGTGG - Intergenic
1123887384 15:24740007-24740029 GACAGAAGTTAGGAGTTTGGGGG + Intergenic
1123999550 15:25743411-25743433 AACTGAAGACAGCTGCCTGGAGG + Intronic
1124024491 15:25952620-25952642 CACTGTGGAGAGCAGTTTGGAGG - Intergenic
1124119733 15:26878582-26878604 AACTGAAGATAGCCTCTAGGAGG - Intronic
1125158728 15:36618971-36618993 AACTGAAGATGGCTCTTTAGGGG - Intronic
1125276831 15:38002787-38002809 AACTCAAAATAGCTGTTTTGAGG - Intergenic
1125918480 15:43510336-43510358 TTCTGAAGATAGCAGTTGGCTGG - Intronic
1125995163 15:44152527-44152549 AACTCAAGAATGCTGTTTGGTGG - Intronic
1128971788 15:72114350-72114372 AACTGAAAATATCTGTTTGTTGG - Intronic
1130511969 15:84596673-84596695 AATTTAAAATAGCAGTTTTGGGG + Intergenic
1130833507 15:87627037-87627059 AGCTGAAGATAGCAGACTGTGGG - Intergenic
1130985847 15:88843894-88843916 AACTGGAGAAAACAGTTTGGAGG - Intronic
1133384651 16:5359384-5359406 CACTGAGGAGAACAGTTTGGAGG - Intergenic
1133765137 16:8832637-8832659 AATTGAAGGGAGCAGTTAGGAGG - Intronic
1134782063 16:16907224-16907246 AAATGAGGACACCAGTTTGGTGG + Intergenic
1134797123 16:17050890-17050912 TACTGTGGAAAGCAGTTTGGAGG - Intergenic
1134822994 16:17261649-17261671 GCCTGAAGATTGCAATTTGGAGG - Intronic
1135181013 16:20274581-20274603 AACTAAATTTAGCTGTTTGGAGG + Intergenic
1135815594 16:25629538-25629560 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1137539691 16:49353742-49353764 AACAGAAGAGAGCAGATCGGTGG - Intergenic
1138560709 16:57799437-57799459 AAGTGAAGATAGCTATTTGAAGG + Intronic
1139099948 16:63753624-63753646 AACTAAAGATAGCAGAAAGGAGG + Intergenic
1140592718 16:76372452-76372474 AACTCAAGATAAGATTTTGGTGG - Intronic
1141270028 16:82531170-82531192 AAATGAAAATAGCATTTTAGAGG + Intergenic
1143420320 17:6785924-6785946 CACTGTAGAGAACAGTTTGGAGG + Intronic
1144613254 17:16744261-16744283 CACTGTGGAAAGCAGTTTGGAGG - Intronic
1144899485 17:18571047-18571069 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1145132917 17:20374334-20374356 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1147140292 17:38456811-38456833 ATCTGAAGACAAGAGTTTGGAGG - Intronic
1148188140 17:45659536-45659558 CACTGGGGAAAGCAGTTTGGTGG - Intergenic
1148228369 17:45915650-45915672 AACTGAACACAGCACTTTAGAGG + Intronic
1149249120 17:54747771-54747793 CACTGCAGAGAGCAGTTTGGAGG - Intergenic
1150709571 17:67519025-67519047 AACTGTGGAAAACAGTTTGGTGG + Intronic
1153831550 18:8928255-8928277 TGCTGAGGAAAGCAGTTTGGTGG + Intergenic
1155384759 18:25265620-25265642 AACTACAGAGAACAGTTTGGAGG + Intronic
1155539456 18:26852849-26852871 AACTGAAGATGGAAGTCTGGGGG - Exonic
1156225877 18:35106944-35106966 AACTCAAGATAGCTGTTGGTGGG + Intronic
1157279548 18:46336835-46336857 AACTGAAGATTGCACTTAGTTGG + Intronic
1157456453 18:47834033-47834055 AGCTGAAGGTACCAGTATGGTGG - Exonic
1157512987 18:48291777-48291799 AAGTGAACACAGCAGTTAGGGGG + Intronic
1158015746 18:52781396-52781418 AAGCTCAGATAGCAGTTTGGTGG - Intronic
1158528904 18:58240578-58240600 AACTGAATGTAGCAGGTAGGTGG - Intronic
1159100665 18:63954582-63954604 AAATAAAGATAGCAATGTGGTGG + Intronic
1159740784 18:72167439-72167461 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1161868180 19:6850005-6850027 CACTGCGGAAAGCAGTTTGGAGG - Intronic
1163948122 19:20559664-20559686 AACTGTAAAAAGCAGTGTGGCGG + Intronic
1164004652 19:21137327-21137349 AACTGAAGATAGATGTTAGTAGG - Intergenic
1164026436 19:21357617-21357639 AACTGAAGATAGATGTTAGTAGG + Intergenic
925796724 2:7553698-7553720 AACAGAACATAGTAGCTTGGAGG - Intergenic
926621896 2:15054063-15054085 AACTGAAGAGTCCTGTTTGGAGG - Intergenic
928767660 2:34666898-34666920 AACAGAAGATAGCAGTTCTCTGG + Intergenic
929100098 2:38303031-38303053 AATTCAAAATAGCAGTTTTGAGG + Intronic
929524825 2:42692397-42692419 AATTCAAGATAGCTGTTTTGAGG - Intronic
929969017 2:46557147-46557169 AACTGAAACAACCAGTTTGGAGG + Intronic
930475598 2:51876946-51876968 AATTCAAAATAGCAGTTTTGAGG + Intergenic
931940816 2:67250015-67250037 CACTATAGAGAGCAGTTTGGAGG - Intergenic
932497800 2:72155323-72155345 GACTGAAGTGAGCAGTATGGAGG - Intergenic
934527854 2:95062677-95062699 AAATGAAGAGAGCACATTGGAGG - Intergenic
935853035 2:107243760-107243782 AAGTGAGAATATCAGTTTGGGGG - Intergenic
936793645 2:116182208-116182230 CACTATAGAAAGCAGTTTGGAGG - Intergenic
936909596 2:117576365-117576387 AACTCAAGATGGCATTTAGGTGG + Intergenic
938068976 2:128298238-128298260 TACTGTAGAAAGCAGTATGGTGG + Intronic
940134993 2:150425612-150425634 ACCTGAGGATACCATTTTGGGGG - Intergenic
940443190 2:153744247-153744269 CACTATAGAGAGCAGTTTGGAGG - Intergenic
940615743 2:156047169-156047191 CACTGTGGAAAGCAGTTTGGTGG + Intergenic
940720120 2:157272926-157272948 CACTGTAGAAGGCAGTTTGGAGG - Intronic
941248957 2:163137681-163137703 AGAAGAAGATAGGAGTTTGGGGG - Intergenic
941539651 2:166766507-166766529 ATCAGAAGCTTGCAGTTTGGAGG - Intergenic
941955205 2:171196722-171196744 ATCTGAAGGCAGCAGTCTGGAGG + Intronic
942081734 2:172406109-172406131 CACTGTTGAAAGCAGTTTGGGGG - Intergenic
942795353 2:179812212-179812234 AACTGGGGAAAGCAGTTTGGAGG + Intronic
943082182 2:183268370-183268392 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
943957515 2:194211413-194211435 TACTGAAGATAGAAATCTGGAGG - Intergenic
945146474 2:206743505-206743527 AAATGAAGCTATCAGTATGGTGG - Intronic
945766530 2:213986669-213986691 ATATGAAAATAGCTGTTTGGAGG - Intronic
945947002 2:216004056-216004078 AACTGAAGAGGGCAGGGTGGTGG - Intronic
946811645 2:223531458-223531480 AAGTGAAGAGGGCAGTTTCGTGG + Intergenic
1170256920 20:14355173-14355195 CACTGTGGAAAGCAGTTTGGAGG - Intronic
1170810546 20:19670789-19670811 AACTGAAAATTGATGTTTGGAGG + Intronic
1171148811 20:22809177-22809199 AACTGCAGATTGCAGCTGGGAGG - Intergenic
1173085744 20:39914867-39914889 AACTGAAGAGTACAGTTGGGAGG + Intergenic
1173316297 20:41947505-41947527 CACTGTAGAAAACAGTTTGGTGG + Intergenic
1177040115 21:16097762-16097784 AAGTGAAGACACCAGTTAGGAGG - Intergenic
1177423048 21:20886621-20886643 CACTGTGGATACCAGTTTGGAGG - Intergenic
1178074383 21:29001704-29001726 AATTGAAGATGGAAGTTTCGTGG - Intergenic
1178576101 21:33792984-33793006 AACTGGAGATAGGGGTCTGGGGG - Intronic
1181554308 22:23658984-23659006 AACTCAGGATGGCAGTTTGGTGG - Intergenic
1181895486 22:26103992-26104014 GACAGAGGTTAGCAGTTTGGAGG - Intergenic
1182121424 22:27789718-27789740 AACTGAATCTAGCAGTTTGGAGG - Intronic
950616402 3:14163174-14163196 AACTGCAGAAAACAGTTTGGTGG + Intronic
951378774 3:21956930-21956952 AACTGAAGTTGACATTTTGGTGG - Intronic
951740534 3:25917472-25917494 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
952873033 3:37919117-37919139 AACTGAAAAGAGCTGCTTGGTGG - Intronic
953423914 3:42777111-42777133 CACTGTAGAAAACAGTTTGGTGG + Intronic
954136801 3:48585622-48585644 GAAAGAAGATAGCAGTTAGGTGG + Intronic
955247452 3:57239754-57239776 CACTGTAGAAAACAGTTTGGTGG - Intronic
956019151 3:64915075-64915097 GACTGAAGAGACCAGTTGGGAGG + Intergenic
956502443 3:69901049-69901071 AAGTGAATTGAGCAGTTTGGAGG + Intronic
956618246 3:71194155-71194177 ATATGAAGAGAGCAGTTTAGAGG - Intronic
959319626 3:104855094-104855116 AACTGTAGATAGCTTTTTGGGGG - Intergenic
959457890 3:106586499-106586521 AACTGAGGATAACTGTGTGGTGG - Intergenic
960079400 3:113525362-113525384 AACTCAAGATGGCCTTTTGGTGG - Intergenic
960153385 3:114273936-114273958 AACTTAAAATAGCTGTTTTGAGG - Intergenic
962938315 3:140102140-140102162 AACTGTAGACAGCAGTTTATAGG - Intronic
963365539 3:144329809-144329831 TACTAAGGATAACAGTTTGGTGG + Intergenic
964736111 3:159919925-159919947 CACTGTAGACAACAGTTTGGTGG + Intergenic
964903035 3:161683021-161683043 TACTGTAGAGAGCAGTTTGGAGG + Intergenic
965014434 3:163139256-163139278 AACTCAAGATAGCTGATTTGAGG - Intergenic
966687652 3:182713454-182713476 CACTGTAGAAAGCAGTTTGGAGG + Intergenic
968004815 3:195235446-195235468 AATTGAAAATAGCTGTTTTGAGG - Intronic
968218681 3:196916430-196916452 AATTGAAAATAGCTGTTTTGAGG + Intronic
970071053 4:12161000-12161022 AACTGAAAATAGCTGTGTTGAGG - Intergenic
971044261 4:22787838-22787860 AATTGTGGAAAGCAGTTTGGAGG - Intergenic
971227830 4:24771271-24771293 GAGTGAAGACAGAAGTTTGGTGG - Intergenic
971627815 4:28945836-28945858 TACTGTAGAGAGCAGTTTGGAGG + Intergenic
971861033 4:32106218-32106240 AACTGAAGGTAGAATTTTGGGGG - Intergenic
972140553 4:35953893-35953915 CACTGTGGAAAGCAGTTTGGAGG - Intronic
972224339 4:36995263-36995285 ACCTGGAGATAGCAGTTTGAGGG + Intergenic
972868599 4:43267668-43267690 TCCTGTAGAAAGCAGTTTGGAGG - Intergenic
974938134 4:68432170-68432192 AACTGAAGATTGCAGTATTTTGG + Intergenic
974939263 4:68444439-68444461 GAATGAAGATAACATTTTGGGGG - Intergenic
974981727 4:68965691-68965713 AACTCAAGATAAGATTTTGGTGG + Intergenic
976728340 4:88238851-88238873 AATTCAAAATAGCTGTTTGGGGG - Intergenic
977442100 4:97080774-97080796 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
977854859 4:101876756-101876778 AACTCAAAATAGCTGTTTTGAGG + Intronic
978698699 4:111616264-111616286 AACCTAAGATAGCATTTTTGAGG - Intergenic
978928280 4:114277732-114277754 CACTGTAGAGAGCAGTTTGGAGG - Intergenic
979483876 4:121248822-121248844 AACTGAACATGGTAGTTTAGAGG - Intergenic
980597075 4:134967843-134967865 AATTCAAGATAGCTGTTTTGAGG + Intergenic
980645038 4:135633087-135633109 AAATTAAGATAGCAGATTGGAGG - Intergenic
981610654 4:146590399-146590421 GACTGAAGATACAAATTTGGGGG + Intergenic
982644129 4:158001042-158001064 AAATGAAGATAGGAGGTGGGAGG + Intergenic
984595077 4:181657562-181657584 CACTGCAGAAAGCACTTTGGAGG + Intergenic
985116964 4:186601268-186601290 AACTGACTATAGCATCTTGGAGG - Exonic
986158107 5:5196974-5196996 AGCTGAAGACAGCAGTTGCGGGG - Intronic
986671907 5:10150222-10150244 AAGAGATGATAGCAGTGTGGAGG + Intergenic
986856449 5:11874278-11874300 AACATAAGATAGCAGTCTGAGGG + Intronic
987189089 5:15455174-15455196 CACTGAGGAGAACAGTTTGGAGG - Intergenic
987537541 5:19207841-19207863 AATTTAAAATAGCTGTTTGGAGG + Intergenic
988347332 5:30055520-30055542 CACTAAGGAGAGCAGTTTGGAGG - Intergenic
988405052 5:30813763-30813785 AAAGGAAAATAGTAGTTTGGAGG - Intergenic
988692188 5:33583562-33583584 CACTGTGGAGAGCAGTTTGGAGG - Intronic
992642224 5:78778079-78778101 AACTGGAGACAGCTGTTGGGAGG + Exonic
992827282 5:80562952-80562974 AACTGAAAAAAGCAACTTGGAGG + Intronic
993608678 5:90027778-90027800 AAATGATGATAGCATTTTGATGG - Intergenic
993682133 5:90892659-90892681 AACTGGAGATAGAAGAGTGGGGG - Intronic
994237082 5:97375201-97375223 CACTGTAGAAAGCAGATTGGAGG + Intergenic
994445601 5:99869518-99869540 CACTATAGATAACAGTTTGGAGG - Intergenic
995726743 5:115189282-115189304 AAATGAAGATAGAAGGTAGGTGG - Intergenic
996198437 5:120639712-120639734 CACTGTGGAAAGCAGTTTGGAGG + Intronic
996390600 5:122956604-122956626 CACTGTAGATAACAGTATGGTGG - Intronic
997937490 5:138126205-138126227 AACTGAAAATAACAGTTGGCTGG + Intronic
998005299 5:138652790-138652812 AACTCAAGCAAGCAGTCTGGCGG - Intronic
998916377 5:147016342-147016364 AAAAGATGATAGCAGTTTTGGGG + Intronic
999660332 5:153855988-153856010 AACTCAAAATAGCAGTTTTAAGG - Intergenic
1000492956 5:161938183-161938205 CACAGTAGAAAGCAGTTTGGAGG - Intergenic
1002915912 6:1527513-1527535 AGCTGAAGAGAGCTTTTTGGAGG - Intergenic
1004092422 6:12517567-12517589 TACTGTAGAAAACAGTTTGGAGG + Intergenic
1004525831 6:16406866-16406888 AACTGGACATAGCAGTAGGGTGG + Intronic
1008282556 6:49613685-49613707 AACTCAAGAGACCAATTTGGGGG + Intronic
1008289269 6:49693867-49693889 AATTCAAAATAGCTGTTTGGAGG - Intronic
1009809769 6:68645990-68646012 AACTGAAGAAGGGAGTTTGAGGG - Intronic
1010018877 6:71137121-71137143 AACTGTGGAGAACAGTTTGGAGG + Intergenic
1010551858 6:77233016-77233038 AACTGTGGATAGCAGGTTGAGGG - Intergenic
1011238711 6:85247243-85247265 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1011926226 6:92648488-92648510 AAATGAAGATCTCAGGTTGGGGG + Intergenic
1012486094 6:99724156-99724178 AACTCAAAATAGCTGTTTTGAGG - Intergenic
1012568514 6:100692675-100692697 AAATGAAGATGTCAGTTTTGTGG + Intronic
1014092257 6:117417097-117417119 AGCTGCAGTTAGAAGTTTGGGGG - Intronic
1016879308 6:148895169-148895191 AAGTGAAGAAAGAAGGTTGGGGG - Intronic
1018536170 6:164822342-164822364 AACTATGGATAACAGTTTGGAGG + Intergenic
1019196966 6:170288688-170288710 AACTGGGGAAAGCAGTTTTGGGG + Intronic
1020345468 7:7157753-7157775 AACTGAAATTTGAAGTTTGGTGG - Intronic
1021041711 7:15871065-15871087 ATCTGAACATAGCATTTTGGGGG - Intergenic
1021202732 7:17743611-17743633 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1021412862 7:20347754-20347776 AACTGAAGGTACCAATTTGGTGG + Intronic
1022024182 7:26430468-26430490 AATGGAAGGAAGCAGTTTGGAGG + Intergenic
1023158232 7:37273235-37273257 AATTGAAGATGAGAGTTTGGTGG - Intronic
1023567506 7:41538300-41538322 ACCTGAAGATGCCAGTTTAGGGG - Intergenic
1023721914 7:43104775-43104797 AACTGAAGTCAGCAGTGAGGAGG - Intergenic
1024274109 7:47663860-47663882 AACTGAAGAAAGGAGCTTGGGGG - Intergenic
1024332217 7:48167252-48167274 TACTGTAGAAAGCAGTTTGGAGG + Intergenic
1025926359 7:65963421-65963443 AACTGAAGATAGCAGTTTGGTGG - Intronic
1027812467 7:82922158-82922180 CACTGTGGAAAGCAGTTTGGAGG + Intronic
1028219365 7:88177764-88177786 ACCTGAAAATGGCATTTTGGGGG + Intronic
1029088471 7:98029990-98030012 AACTATAGAGAACAGTTTGGAGG - Intergenic
1029795020 7:102885198-102885220 ACCTGAAGAAAACATTTTGGTGG - Intronic
1030441066 7:109590665-109590687 AAATGATGATAGTAATTTGGAGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034103897 7:148474357-148474379 AATTGAAAACAGCATTTTGGAGG - Intergenic
1034581624 7:152049054-152049076 AATTCAAGATAGCTGTTTTGAGG - Intronic
1037932938 8:22894141-22894163 CATTGAAGATAAGAGTTTGGCGG + Intronic
1038153995 8:24970264-24970286 CACTAAAGAGAGCAGTATGGAGG - Intergenic
1039313704 8:36348485-36348507 AGCTGTAGAAAGCAGTTTGTTGG + Intergenic
1042652230 8:71055745-71055767 AACTGAAAATTAAAGTTTGGGGG + Intergenic
1043227195 8:77747143-77747165 AATTCAAAATAGCAGTTTGGAGG + Intergenic
1045306639 8:100962786-100962808 AGACGAAGATAGCATTTTGGAGG + Intergenic
1048618787 8:136108904-136108926 AACTGAACATAACATTTGGGTGG - Intergenic
1048715485 8:137264145-137264167 GACTCAGGAAAGCAGTTTGGAGG + Intergenic
1050022716 9:1301716-1301738 ATCAAGAGATAGCAGTTTGGGGG + Intergenic
1050121780 9:2315843-2315865 AATTAAAAATAGCTGTTTGGAGG - Intergenic
1056295352 9:85187766-85187788 AACTGAAGACATCAGTGAGGTGG - Intergenic
1057282221 9:93721079-93721101 AACAGAAGATGGCAGGATGGAGG - Intergenic
1057614082 9:96572380-96572402 ACCTGGAGATAGCAGGTTGAGGG - Intronic
1057927013 9:99161685-99161707 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1058412163 9:104746082-104746104 ACTTGCAGATAACAGTTTGGGGG + Intergenic
1058798777 9:108524237-108524259 AACTCAAGATAACAGTATCGTGG - Intergenic
1059180089 9:112203594-112203616 CACTGTGGAGAGCAGTTTGGAGG - Intergenic
1060395993 9:123317329-123317351 AGTTGAAGATAGTAGGTTGGTGG - Intergenic
1061526219 9:131165544-131165566 CACTGTAGAAAACAGTTTGGTGG + Intronic
1061668844 9:132176761-132176783 ACCTGTAGAAAACAGTTTGGTGG - Intronic
1061674857 9:132209896-132209918 GACTGAAGATAGCTGTGGGGAGG + Intronic
1187498174 X:19814279-19814301 AAGCGAGGAGAGCAGTTTGGAGG - Intronic
1187742278 X:22368882-22368904 AACTGAATAAAGCAGTTGGCAGG + Intergenic
1188192110 X:27183597-27183619 AACTGAAAATATCTGTTTTGAGG + Intergenic
1188206563 X:27366537-27366559 AACTATGGACAGCAGTTTGGAGG + Intergenic
1189894448 X:45639662-45639684 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1190757358 X:53412568-53412590 AACTGAAGCTAGAAGTTTAAAGG - Intronic
1191703887 X:64072058-64072080 AACTCAAGCTAGCAGTTTTGAGG + Intergenic
1192077534 X:68015650-68015672 AAATGAAGAGACCAGTTAGGAGG + Intergenic
1192393560 X:70755182-70755204 AATTGAAAATAGCTGTTTTGAGG + Intronic
1192923922 X:75735972-75735994 AATTCAAAATAGCAGTTTGAAGG - Intergenic
1192947423 X:75981405-75981427 AATTCAAAATAGCAGTTTGAAGG - Intergenic
1194360904 X:92949546-92949568 AATTTAAAATAGCAGTTTTGAGG - Intergenic
1195121687 X:101760504-101760526 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1195489298 X:105448979-105449001 AACTCAAAATAGCTGTTTAGAGG - Intronic
1195735293 X:108006752-108006774 CACTGTGGAAAGCAGTTTGGAGG + Intergenic
1195971534 X:110478522-110478544 CACTGTGGAAAGCAGTTTGGAGG - Intergenic
1196269920 X:113698624-113698646 AATTGAAAATAGCAGTGTTGAGG - Intergenic
1196514853 X:116597666-116597688 CACTCAGGAGAGCAGTTTGGAGG - Intergenic
1197117838 X:122853950-122853972 CACTGTAGAGAACAGTTTGGAGG + Intergenic
1198187244 X:134265432-134265454 AACTGGAGTTATCAGTTTTGAGG - Intergenic
1198191842 X:134315185-134315207 ATCTGAAGATAGCTGTTAGTTGG - Intergenic
1198438571 X:136640045-136640067 AACTGAAGAGGGCAGCCTGGAGG + Intergenic
1199795628 X:151192640-151192662 AATTCAAAATAGCTGTTTGGAGG + Intergenic
1200138832 X:153887286-153887308 AACTGAAGCTGGCACTATGGGGG - Intronic
1200374230 X:155762783-155762805 CACTGTAGAAAGCAGTTTGGAGG + Intergenic
1201977057 Y:19862498-19862520 AACTCAAAATAGCAGTTTTGAGG - Intergenic
1202194592 Y:22286366-22286388 CACTGTGGAAAGCAGTTTGGGGG + Intergenic