ID: 1025927241

View in Genome Browser
Species Human (GRCh38)
Location 7:65969994-65970016
Sequence CTGTTTTCACAGATGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 17, 2: 2, 3: 25, 4: 267}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025927241_1025927253 29 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927253 7:65970046-65970068 CACCTGTAACCCCAGCCCTTTGG 0: 13
1: 1813
2: 75572
3: 214783
4: 287887
1025927241_1025927246 -7 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927246 7:65970010-65970032 AAAACAGACTGGCTGCGGCCGGG No data
1025927241_1025927249 2 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927249 7:65970019-65970041 TGGCTGCGGCCGGGGTGTGGTGG No data
1025927241_1025927247 -6 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927247 7:65970011-65970033 AAACAGACTGGCTGCGGCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 79
1025927241_1025927248 -1 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927248 7:65970016-65970038 GACTGGCTGCGGCCGGGGTGTGG No data
1025927241_1025927254 30 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927254 7:65970047-65970069 ACCTGTAACCCCAGCCCTTTGGG 0: 13
1: 1921
2: 80974
3: 313285
4: 270653
1025927241_1025927245 -8 Left 1025927241 7:65969994-65970016 CCAAAGACCATCTGTGAAAACAG 0: 1
1: 17
2: 2
3: 25
4: 267
Right 1025927245 7:65970009-65970031 GAAAACAGACTGGCTGCGGCCGG 0: 2
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025927241 Original CRISPR CTGTTTTCACAGATGGTCTT TGG (reversed) Intronic
901938186 1:12642376-12642398 CTGTTTTCAAAAATGCTCTGGGG + Intergenic
902624599 1:17669254-17669276 GTGTTTTCACATTTGGTCCTGGG - Intronic
903130339 1:21275246-21275268 CTGTTATCACACAGGGACTTGGG + Intronic
903143705 1:21356129-21356151 CTGTTTTCACAGCAGGTGTTGGG + Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
907201327 1:52729150-52729172 CTGTTTTCACACATGGTGGCAGG + Intronic
908049435 1:60211871-60211893 CAGTTTTCACAAATGTGCTTCGG + Intergenic
910820834 1:91344090-91344112 CTGTTTTAACTGATGCTTTTAGG + Intronic
912279046 1:108294155-108294177 GTGTTTTCAAAGAGGGTCTTTGG + Intergenic
912289180 1:108400202-108400224 GTGTTTTCAAAGAGGGTCTTTGG - Intronic
913018608 1:114764393-114764415 CTGCTTTCACAGCTGGCGTTAGG - Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
914373656 1:147052577-147052599 CTCATTCCTCAGATGGTCTTTGG - Intergenic
915105378 1:153532297-153532319 CAGTTTACAGAGATGGTCTGTGG + Intergenic
917746637 1:178015225-178015247 CTGGTTTCACAGAATGACTTAGG + Intergenic
922221179 1:223609816-223609838 CAGTTTTCACAGATAGTCAAAGG - Intronic
922703007 1:227772792-227772814 CTGGTTTACCAGATGGTGTTGGG - Intronic
1063008688 10:2000598-2000620 CTGTTTTAACAGAAGATTTTGGG + Intergenic
1064689246 10:17897001-17897023 CTGTGGTCACAGATGATCATAGG + Intronic
1064812759 10:19219959-19219981 TTGTTATCATAGATGGTCCTTGG + Intronic
1068342334 10:55721798-55721820 CTCTTATCACAGATGATTTTTGG - Intergenic
1069345387 10:67463408-67463430 CAGTTTTTTCAGATGGTCTTTGG - Intronic
1069757528 10:70782309-70782331 CTGGTTTCAGATATGGTCTCTGG - Intronic
1070617481 10:77979900-77979922 CTGTCAGCACAGATGGTTTTTGG - Intronic
1070849001 10:79547739-79547761 GTGCTCTCACAGCTGGTCTTTGG + Intergenic
1070924790 10:80212456-80212478 GTGCTCTCACAGCTGGTCTTTGG - Intergenic
1071105673 10:82091612-82091634 CTGTTTGTACAGCTGGTCTTGGG - Intronic
1072823000 10:98576748-98576770 CTGTTTTCTCAGACTGTGTTGGG - Intronic
1074345989 10:112686990-112687012 CTGTCTTCTCAGATGCTCTGTGG + Intronic
1074875850 10:117612839-117612861 GTGATTACACAGATGGGCTTCGG + Intergenic
1076009755 10:126978422-126978444 CTTTTTTCACAGCTTGACTTAGG - Intronic
1076475519 10:130749075-130749097 CTGTTTTCAAATATGAGCTTCGG - Intergenic
1076563000 10:131379651-131379673 TTGTTTTCACAGAGAGTCTGAGG + Intergenic
1078681368 11:13479824-13479846 ATTGTTTCACAGATGGTGTTTGG + Intergenic
1079706577 11:23628173-23628195 CTTTTTTCATAAATGGTGTTGGG - Intergenic
1084850939 11:71939537-71939559 CCATTTTCACAGATCATCTTAGG + Intronic
1086102453 11:83115554-83115576 CTGTTTTCTTTGATGGTGTTTGG + Intergenic
1087511328 11:99098887-99098909 CTGTCTAGACAGATGGTCTCTGG - Intronic
1088903476 11:114136323-114136345 CTGTTTCCACAGTTGCTTTTGGG - Intronic
1088919762 11:114252357-114252379 CTATTTTCACGGCTGGTCTTTGG + Intergenic
1089093667 11:115899961-115899983 CTGTTTTCACAGATGTTCCTGGG + Intergenic
1089094688 11:115909907-115909929 CTGGCATCACAGAGGGTCTTGGG - Intergenic
1089417637 11:118305778-118305800 CTGGTCTCACAGATTGGCTTCGG - Intronic
1090983188 11:131741437-131741459 CTGTTTTCTCAGATTACCTTTGG + Intronic
1092546668 12:9458019-9458041 CTTTTTCCAAAGAGGGTCTTGGG + Intergenic
1093960233 12:25264659-25264681 CTGTTTCCAGAGCTGGTCTGGGG - Intergenic
1094231305 12:28106826-28106848 CTTCTTTTACAGATGCTCTTAGG - Intergenic
1094506269 12:31064053-31064075 CTTTTTCCAAAGAGGGTCTTGGG - Intergenic
1095446621 12:42288656-42288678 CTCATTCCTCAGATGGTCTTTGG - Intronic
1096310720 12:50518197-50518219 TTGGGTTCACATATGGTCTTGGG + Intronic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1097735596 12:63177830-63177852 CTTGGTTCACACATGGTCTTTGG - Intergenic
1098088867 12:66879526-66879548 GTGGCTTCACATATGGTCTTTGG - Intergenic
1099645706 12:85352976-85352998 CTGTTTTCTGAGATGTTCTATGG - Intergenic
1102284252 12:111642447-111642469 CTGTTTTCCCAGGTGGTGGTGGG + Exonic
1105359840 13:19699738-19699760 CTGTGTTCATAGATGTTTTTAGG - Intronic
1107318655 13:39161849-39161871 CTGATTCCACAGATTCTCTTTGG + Intergenic
1107502252 13:40992289-40992311 GTGTGTTCACAGATGCACTTAGG - Intronic
1109091998 13:58059453-58059475 CTGTTTTCAAATCTGTTCTTAGG - Intergenic
1110220796 13:73070746-73070768 CTGTTTAAACAAATTGTCTTAGG - Intronic
1111132554 13:83996298-83996320 CTGGGTTCACAGATGGTTTGAGG - Intergenic
1112324171 13:98432459-98432481 CTGGTGTCACAGTTGGTCTGTGG + Intronic
1113197484 13:107825672-107825694 CTCTTTTCACAGATTTTCATGGG - Intronic
1113307932 13:109098169-109098191 CTGTGTTCTCACATGGTGTTAGG + Intronic
1113522825 13:110952876-110952898 CTGTGTGTACAGATGGCCTTAGG - Intergenic
1113644029 13:111979866-111979888 CTGCTGTCACAGATGGCCTCTGG - Intergenic
1113702549 13:112397961-112397983 CTGTGTGTACAGATGGCCTTAGG + Intronic
1114349127 14:21830578-21830600 ATGGTTTCACAGATGGTATCTGG - Intergenic
1114656241 14:24317215-24317237 CTGTTTTCTCAGAAGGTCCCGGG - Exonic
1115957620 14:38798812-38798834 TTGTTTTCACTGATGTGCTTGGG + Intergenic
1117518454 14:56526109-56526131 CTGTGTTCTCAGATGTTCTCGGG - Intronic
1119828732 14:77681644-77681666 CTGCTTACAAAGATGGTCCTTGG + Intronic
1120982207 14:90300128-90300150 TTCTTATCACAGAGGGTCTTAGG + Intronic
1121756398 14:96406296-96406318 CTGCTGTCACAGATGGGCATTGG + Intronic
1122983652 14:105202552-105202574 CTGCTTCCCCAGATGGTCCTGGG + Intergenic
1126395854 15:48216515-48216537 CCTTTTTTAAAGATGGTCTTGGG - Intronic
1128436955 15:67662277-67662299 CTTATTTCACAGTTGCTCTTAGG + Intronic
1129044829 15:72725553-72725575 CTGTTTTCAGAGATATTATTAGG + Intronic
1130177314 15:81587115-81587137 GAGTTTTCAAAGAGGGTCTTTGG + Intergenic
1131995429 15:98128334-98128356 CTTTTTTCACACATGTGCTTGGG - Intergenic
1134010203 16:10846353-10846375 ATGTCTTCACAGAAGGTGTTAGG - Intergenic
1137539565 16:49353049-49353071 CTGGTTTGCCAGATGGCCTTGGG - Intergenic
1138372462 16:56538087-56538109 CTCCTTCCACAGATGGTCTGTGG + Intergenic
1138728178 16:59163661-59163683 TTCTTGGCACAGATGGTCTTAGG + Intergenic
1139471511 16:67180396-67180418 CCGTTCTCACAGATGCTCCTGGG - Exonic
1140606319 16:76543438-76543460 CTGTCTTCACAGCTGTTGTTTGG - Intronic
1141258694 16:82430329-82430351 CTGGTTTCACAGAATGTGTTAGG - Intergenic
1142404363 16:89879115-89879137 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404378 16:89879199-89879221 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404402 16:89879367-89879389 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404407 16:89879409-89879431 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404414 16:89879451-89879473 CCGTGTACACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1145899286 17:28479557-28479579 CTGTTTTTACAGATGCCTTTGGG - Intronic
1146261668 17:31426018-31426040 CTTTTGCCACAGATGGTCCTCGG - Intronic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1149005947 17:51805585-51805607 CTGTTTTTAAAAATGTTCTTGGG - Intronic
1151615338 17:75206481-75206503 CTTTTTCCAAAGATGGTTTTGGG + Intronic
1152203168 17:78958875-78958897 CGGTGTTCATAGATGGTCTGGGG - Intergenic
1155742478 18:29306451-29306473 CTGTTTTCACAGATTATCTAGGG - Intergenic
1157273065 18:46291238-46291260 CTCTTATGACAGATGGTGTTGGG + Intergenic
1157578118 18:48757556-48757578 CTGTCATCACATATGGCCTTTGG - Intronic
1159269889 18:66134954-66134976 CTGCTGTCACAGAAGGTCTGTGG - Intergenic
1160090215 18:75819694-75819716 CTGGTTTTACAGCAGGTCTTTGG - Intergenic
1160105767 18:75974494-75974516 CTTTCTTCACAAATGGTGTTTGG - Intergenic
1160898112 19:1412304-1412326 CTGGTTTCCCACCTGGTCTTAGG + Intronic
1162479955 19:10922238-10922260 CTGGCTTCACAGAGGGTCTGCGG - Exonic
1163269974 19:16247283-16247305 CTTTATTAAAAGATGGTCTTAGG - Intergenic
1165833833 19:38743065-38743087 ATGTCTTCACAGATGAACTTCGG + Exonic
1166707569 19:44916515-44916537 ATATTTTAAAAGATGGTCTTGGG + Intronic
1168373392 19:55855328-55855350 CTCTTTTCACAGTTGGTTTGAGG + Intronic
924981767 2:229263-229285 CAGTTTTGACATATGTTCTTTGG - Intronic
925156297 2:1651136-1651158 CTATTTTCACAGCTACTCTTGGG + Intronic
925567951 2:5276991-5277013 CTGCATTCGCAGATGGTGTTAGG - Intergenic
925863428 2:8202423-8202445 CTGGTGTCACACATGGTCTCAGG + Intergenic
926462232 2:13145252-13145274 CTGTTTTTAAAGAGGGACTTGGG + Intergenic
926838328 2:17049513-17049535 CTGTTTTCAGGTATGGTATTTGG + Intergenic
927073243 2:19551007-19551029 CTGTTTTCACAGGTTTTCTTTGG + Intergenic
927599706 2:24430287-24430309 CTGTTTTCACTGATGGTTTAAGG + Intergenic
928059881 2:28101044-28101066 CTGTTATCCCAGATCATCTTGGG - Intronic
928569119 2:32585180-32585202 ATCTTTTCACAGGTTGTCTTTGG - Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
929323432 2:40575829-40575851 CTGATTTCACTGATCTTCTTTGG + Intronic
930806725 2:55497844-55497866 CAGTTTTCACAGAAGTTCCTGGG + Intergenic
931743176 2:65267234-65267256 CTGTTGTCACATATTGTCTGTGG + Intronic
931956742 2:67435484-67435506 CTGGTTTCACAAATGGGCTTAGG + Intergenic
933126546 2:78615305-78615327 CTGTGTCCAGAGATGCTCTTTGG + Intergenic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934662400 2:96150171-96150193 CTGTGTTCCCAGATGGGCCTGGG + Intergenic
935227613 2:101067366-101067388 CAGTTTTCACAGACTGTCGTGGG + Intronic
935486726 2:103665215-103665237 ATGTTTTCACACATGGTTCTGGG - Intergenic
935939516 2:108223475-108223497 CTGTTTTCTCAGAAGGGCTTCGG + Intergenic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
937669766 2:124525910-124525932 CTGTTTTCACTGGTGGGCTGTGG - Intronic
937888455 2:126916357-126916379 CTGTTTTCTCTAATGGTTTTGGG + Intergenic
941862105 2:170293465-170293487 ATGTTTTCACAGATATTTTTTGG + Intronic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
943610444 2:190027148-190027170 CTCTTTTAACAAATGGTGTTGGG - Intronic
945491467 2:210460774-210460796 GTGCTTTCACAGATGATCTGGGG + Intronic
947059343 2:226145152-226145174 CTGTTTTCAGAGATTTTCTGAGG + Intergenic
947261360 2:228226756-228226778 CTGTTTTAACAGATTGTTCTTGG - Intergenic
948573087 2:238929765-238929787 CTGTTTACACAGAAGGGCTGTGG - Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1172669427 20:36624680-36624702 CTGTGAGCACAGATGGTGTTGGG + Intronic
1173126711 20:40342735-40342757 CAGTTTTTACAGATTGGCTTTGG - Intergenic
1174219046 20:48937639-48937661 CTATGTTCACAGATTTTCTTTGG - Intronic
1175689840 20:61057347-61057369 CTGTTCTCGCAGATGGGCTTCGG - Intergenic
1175724516 20:61308718-61308740 CAGTTTTGACAGAAGGCCTTGGG - Intronic
1177104021 21:16932214-16932236 CTGTTTTCAGAGACCCTCTTGGG + Intergenic
1179547726 21:42123974-42123996 CTGTGTGCACAGATGGGCTCTGG + Intronic
1182313919 22:29430184-29430206 CAGTTTTCAAAGATGATTTTTGG + Intergenic
949377385 3:3405476-3405498 CAGGTTTCTCAGGTGGTCTTTGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951631299 3:24724120-24724142 TTTTTTTCACTGTTGGTCTTTGG - Intergenic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
954816031 3:53281455-53281477 CTGTTTTGAGACAGGGTCTTGGG + Intergenic
955760043 3:62270302-62270324 CTGGGATCACAGATGGGCTTTGG - Intronic
956173488 3:66451962-66451984 GTGTTCTCACCGATGGTCTTAGG - Intronic
956298244 3:67738227-67738249 CTTTTTCCACAGATGGGCTGGGG + Intergenic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
957922522 3:86763902-86763924 CGCTTTTCTCAGATGGTATTTGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963876573 3:150482541-150482563 CAGATTTCACAGATGTTGTTAGG - Intergenic
966958319 3:184908117-184908139 CTGTTTTCACAAATGTCCTGGGG + Intronic
967035388 3:185645413-185645435 CTCATTCCTCAGATGGTCTTTGG + Exonic
967601909 3:191400319-191400341 CTCTTTCCTCAAATGGTCTTCGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
969987364 4:11225827-11225849 CTGGTTTTACAGTTGGTCTCAGG + Intergenic
970294319 4:14612205-14612227 CTGTCATCACACATGGTCCTGGG + Intergenic
971343982 4:25795779-25795801 CTGCTTTCACAGAAGGCCTCAGG - Intronic
971404298 4:26307134-26307156 CTGTTTTTACAGATGTGCCTCGG - Intronic
972693742 4:41424383-41424405 CTGTTTTCACAGATTCTTATTGG + Intronic
973100568 4:46263462-46263484 CTTTTTTCACACATGGTGCTGGG - Intronic
973879425 4:55254164-55254186 CTCTTTTCACAGCTGGCCTTCGG + Intergenic
977000671 4:91497040-91497062 ATCTCTCCACAGATGGTCTTAGG + Intronic
977213808 4:94254193-94254215 CTGCTTTGACAGATGTTCTCTGG - Intronic
977875072 4:102140020-102140042 CTGCTTTCACAGATAGACATAGG + Intergenic
977939039 4:102838345-102838367 CTGTGTTCAGTGATGTTCTTTGG + Intronic
978235615 4:106454905-106454927 CTGTTTTCACACATTTTCTTGGG - Intergenic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
979811200 4:125038328-125038350 CTGCTTTGCCAGATGGTCTTAGG - Intergenic
980412642 4:132443424-132443446 GTGTTTCCACAGATAATCTTTGG + Intronic
980545367 4:134254961-134254983 CAGTTTTTGCAGATGTTCTTTGG + Intergenic
980554572 4:134386789-134386811 CTGTTCTCACTGAGGGTCATGGG - Intergenic
981091646 4:140738505-140738527 CTTTTTCCAAAGATGGTTTTGGG - Intronic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
983153185 4:164311494-164311516 CAGTTTGGACAGATGGTCATTGG - Intronic
983676286 4:170297229-170297251 ATGTTTTCCTGGATGGTCTTGGG - Intergenic
985607374 5:865257-865279 CGGTTTCCACAGATGTCCTTGGG - Intronic
985885498 5:2674478-2674500 CTGTATCCACCCATGGTCTTGGG - Intergenic
986684374 5:10263191-10263213 CTGTTTTCAGAGAGGGCCATGGG - Exonic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
986752089 5:10796253-10796275 CTGTTATCACACTGGGTCTTAGG + Intergenic
987218895 5:15769116-15769138 CTGTCTTCCCACATGGCCTTTGG + Intronic
987688747 5:21239934-21239956 CTGTTTTCACACCTGAACTTGGG - Intergenic
987710274 5:21495442-21495464 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988749340 5:34178731-34178753 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
988785559 5:34563252-34563274 CTAATTTCACAGCTGGTCTATGG - Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
990357723 5:54986635-54986657 CTGTTTTCCCAGAGGGACCTAGG - Intronic
990772233 5:59261531-59261553 CTGTCTTTACAGATAATCTTCGG - Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991385854 5:66088630-66088652 ATTTTTTCAAAGATAGTCTTTGG - Intergenic
991385866 5:66088981-66089003 ATTTTTTCAAAGATAGTCTTTGG - Intergenic
991737595 5:69641923-69641945 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991760599 5:69914502-69914524 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991786733 5:70203599-70203621 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991789171 5:70221649-70221671 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991813921 5:70496755-70496777 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991817052 5:70518039-70518061 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991839830 5:70789552-70789574 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
991879178 5:71203984-71204006 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
991881618 5:71222013-71222035 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994055644 5:95411180-95411202 GTGTTTTAACACATGGGCTTTGG + Intronic
994422226 5:99535547-99535569 CTGTTTTCAAAGATGGTCTTTGG + Intergenic
994460145 5:100061993-100062015 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994484293 5:100375418-100375440 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
994711453 5:103269587-103269609 CTATTTTCAGAGCTGGTCTAAGG + Intronic
994711568 5:103271251-103271273 CTGTTTTCAAAGCTGGTCTAAGG + Intronic
995143371 5:108759065-108759087 CTGTTTGAACAGACTGTCTTAGG + Intronic
995375847 5:111473680-111473702 AAGTTTACACAGCTGGTCTTGGG - Intronic
996081223 5:119260459-119260481 CTGTATCCTCACATGGTCTTTGG - Intergenic
996665505 5:126055306-126055328 CAGTTTTTGCAGATGGTATTTGG + Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
997692476 5:135835933-135835955 CTGTTGGCACAGATGCCCTTGGG + Intronic
998381327 5:141727748-141727770 CATTTTACACAGATGGTCATGGG - Intergenic
998896370 5:146804405-146804427 CTTTGTACACAGATGGCCTTGGG - Intronic
1001974363 5:175984750-175984772 TTGTTGTAACAGTTGGTCTTTGG - Intronic
1002243071 5:177859029-177859051 TTGTTGTAACAGTTGGTCTTTGG + Intergenic
1005547414 6:26885077-26885099 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1008165950 6:48138582-48138604 CTGTTTTAACGGTTGGTATTTGG + Intergenic
1008262615 6:49385679-49385701 CTGTTTTCCCAGATGCTCCACGG - Intergenic
1009018177 6:57926144-57926166 CTGTTTTCAAAGATGGTCTTTGG - Intergenic
1009650675 6:66474084-66474106 ATTTTCTCACAGATGGTCCTGGG - Intergenic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1018043366 6:159944622-159944644 CTGATATCTCAGATGGTATTGGG + Intergenic
1018866356 6:167749473-167749495 CTGTGTACACAGATGCTCTCTGG - Intergenic
1021236978 7:18154031-18154053 ATGTTTTAACAGATTGGCTTGGG - Intronic
1022074317 7:26952469-26952491 TTGTTTTCACAGAAGGTCTTAGG - Intronic
1022947970 7:35306704-35306726 CTGATTTCACAGTTGATCTATGG - Intergenic
1023251037 7:38261447-38261469 CTTTTTACACAGAAGGGCTTGGG - Intergenic
1023531454 7:41160301-41160323 CTGTTTTCAGGGATTTTCTTTGG - Intergenic
1024288949 7:47786431-47786453 CAGTCTTCACAGATTGTGTTGGG + Intronic
1025613309 7:63096772-63096794 CTGTTTTCAGAGATGGTCTTTGG + Intergenic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1027338912 7:77184579-77184601 CTGTTTACACAAAAAGTCTTTGG + Intronic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028334650 7:89636764-89636786 CAGTTTCCAGTGATGGTCTTAGG + Intergenic
1028476005 7:91253962-91253984 CTTATTTCACAAATGGTGTTGGG - Intergenic
1030052427 7:105550452-105550474 CTGTTTTCAGAGATGGTTGACGG + Exonic
1030988376 7:116269410-116269432 ATATTTTCACAGAGAGTCTTTGG + Intergenic
1031313109 7:120224283-120224305 CTGTTTTAATATATGGACTTAGG - Intergenic
1032430484 7:131857185-131857207 CTATCTTCAAAGATGCTCTTCGG + Intergenic
1034604577 7:152300257-152300279 CTGTTTGCACAGTTGGTCCTAGG + Intronic
1035789927 8:2295646-2295668 CTGTTTTCGCCGTTAGTCTTAGG + Intergenic
1035802878 8:2426059-2426081 CTGTTTTCGCCGTTAGTCTTAGG - Intergenic
1037445187 8:18958292-18958314 CTGTTAACAGAGATTGTCTTAGG + Intronic
1037604240 8:20423933-20423955 CAGTTTCCACGGATGGTCTGTGG - Intergenic
1038023002 8:23565784-23565806 TTGTTTTAACTGAAGGTCTTAGG + Intronic
1038137360 8:24802200-24802222 CTGTTGTTGCAGTTGGTCTTAGG + Intergenic
1038298611 8:26320976-26320998 CTGTTTTAACACATGGGCTTAGG - Intronic
1039515785 8:38132431-38132453 CTGTTCCCACAGGTGGTCTCTGG - Intronic
1039848753 8:41344428-41344450 CTGTTTTCTCAGATGTCCTGGGG - Intergenic
1041349814 8:56937259-56937281 CTGTTTTCAAAGGTGGTGTGGGG - Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041944131 8:63423054-63423076 CTCTTTTCCCAGGTGGTCTTTGG + Intergenic
1043539554 8:81244134-81244156 CTGTTTTCACAGATCACCTCAGG - Intergenic
1044052829 8:87530142-87530164 CTGTTTTCATAATTGTTCTTGGG - Intronic
1044582855 8:93839433-93839455 CTATTTTCAATGATGGTTTTAGG + Intergenic
1045137084 8:99232930-99232952 CTCATTCCTCAGATGGTCTTTGG + Intronic
1045246256 8:100444077-100444099 CTGTTATCTCTAATGGTCTTTGG + Intergenic
1046087519 8:109456798-109456820 CTGCTTTCAAACATGTTCTTTGG - Intronic
1046476373 8:114749930-114749952 CTTTTTCCAAAGATGGTTTTGGG - Intergenic
1046648243 8:116809042-116809064 CTGTCTTCACAGGTGGTTTCAGG + Intronic
1046673992 8:117088757-117088779 ATGATTTCACAGATGGTGATGGG + Intronic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1053090444 9:35270829-35270851 CCTTTTTAACAAATGGTCTTAGG - Intronic
1053557878 9:39157237-39157259 CTGTTTTCACAGTTGCTCTGTGG + Intronic
1054139236 9:61461714-61461736 CTGTTTTCACAGTTGCTCTGTGG - Intergenic
1054772298 9:69094218-69094240 CTGGTTTCACAGGTAATCTTTGG + Intronic
1056187832 9:84153907-84153929 CTGTTTGCAAAGTTGGTCCTTGG + Intergenic
1056421231 9:86428524-86428546 CTTTTTCCACTGATTGTCTTGGG + Intergenic
1057451982 9:95172076-95172098 CTCTTTTCACTCAAGGTCTTGGG - Exonic
1058384809 9:104422683-104422705 ATGTTTTTAAAGATGATCTTTGG + Intergenic
1058458320 9:105158770-105158792 CTGTTATCACCAATGTTCTTGGG - Intergenic
1059330754 9:113533996-113534018 CTCTTTCCCCAGATGCTCTTAGG + Intronic
1060333344 9:122696806-122696828 TTATTTTTACAGATGGTATTAGG + Intergenic
1061615426 9:131775802-131775824 CTGGTTTCAAGGCTGGTCTTGGG - Intergenic
1185824710 X:3239078-3239100 CTTTTTTCACAGCTGCTTTTTGG + Intergenic
1187029222 X:15468438-15468460 TTGTTTGCACATATGGTCTTGGG + Intronic
1187204256 X:17167218-17167240 ATGTTTTCAGAGATTGCCTTTGG + Intergenic
1188394436 X:29663191-29663213 CTGTGTTCACAGATAGTCAGGGG - Intronic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1193144738 X:78065028-78065050 CCCTTTTCACAGATGGTATAAGG + Intergenic
1194868784 X:99101638-99101660 CTGTTTAAACTGATGGACTTTGG - Intergenic
1198472322 X:136959022-136959044 TTGTTATCACAGATGATCTTGGG + Intergenic
1201300710 Y:12502379-12502401 CTGTTTTCACATGGGGTCTGGGG - Intergenic