ID: 1025929520

View in Genome Browser
Species Human (GRCh38)
Location 7:65982625-65982647
Sequence AAGGCTATGGCCGCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025929520_1025929529 14 Left 1025929520 7:65982625-65982647 CCTTGGGATGCGGCCATAGCCTT No data
Right 1025929529 7:65982662-65982684 GGAGCCCTGACCTTAACCCAGGG No data
1025929520_1025929528 13 Left 1025929520 7:65982625-65982647 CCTTGGGATGCGGCCATAGCCTT No data
Right 1025929528 7:65982661-65982683 TGGAGCCCTGACCTTAACCCAGG No data
1025929520_1025929524 -7 Left 1025929520 7:65982625-65982647 CCTTGGGATGCGGCCATAGCCTT No data
Right 1025929524 7:65982641-65982663 TAGCCTTGACCCTGGGCTTCTGG No data
1025929520_1025929530 15 Left 1025929520 7:65982625-65982647 CCTTGGGATGCGGCCATAGCCTT No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025929520 Original CRISPR AAGGCTATGGCCGCATCCCA AGG (reversed) Intergenic
No off target data available for this crispr