ID: 1025929525

View in Genome Browser
Species Human (GRCh38)
Location 7:65982644-65982666
Sequence GCTCCAGAAGCCCAGGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025929525_1025929530 -4 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data
1025929525_1025929538 23 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929538 7:65982690-65982712 GAGCTCCCTCTTGGTGTTGCAGG No data
1025929525_1025929529 -5 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929529 7:65982662-65982684 GGAGCCCTGACCTTAACCCAGGG No data
1025929525_1025929528 -6 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929528 7:65982661-65982683 TGGAGCCCTGACCTTAACCCAGG No data
1025929525_1025929536 14 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929536 7:65982681-65982703 AGGGGCCAAGAGCTCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025929525 Original CRISPR GCTCCAGAAGCCCAGGGTCA AGG (reversed) Intergenic
No off target data available for this crispr