ID: 1025929526

View in Genome Browser
Species Human (GRCh38)
Location 7:65982650-65982672
Sequence GTCAGGGCTCCAGAAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025929526_1025929538 17 Left 1025929526 7:65982650-65982672 CCCTGGGCTTCTGGAGCCCTGAC No data
Right 1025929538 7:65982690-65982712 GAGCTCCCTCTTGGTGTTGCAGG No data
1025929526_1025929536 8 Left 1025929526 7:65982650-65982672 CCCTGGGCTTCTGGAGCCCTGAC No data
Right 1025929536 7:65982681-65982703 AGGGGCCAAGAGCTCCCTCTTGG No data
1025929526_1025929530 -10 Left 1025929526 7:65982650-65982672 CCCTGGGCTTCTGGAGCCCTGAC No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025929526 Original CRISPR GTCAGGGCTCCAGAAGCCCA GGG (reversed) Intergenic
No off target data available for this crispr