ID: 1025929530

View in Genome Browser
Species Human (GRCh38)
Location 7:65982663-65982685
Sequence GAGCCCTGACCTTAACCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025929520_1025929530 15 Left 1025929520 7:65982625-65982647 CCTTGGGATGCGGCCATAGCCTT No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data
1025929523_1025929530 2 Left 1025929523 7:65982638-65982660 CCATAGCCTTGACCCTGGGCTTC No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data
1025929526_1025929530 -10 Left 1025929526 7:65982650-65982672 CCCTGGGCTTCTGGAGCCCTGAC No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data
1025929525_1025929530 -4 Left 1025929525 7:65982644-65982666 CCTTGACCCTGGGCTTCTGGAGC No data
Right 1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025929530 Original CRISPR GAGCCCTGACCTTAACCCAG GGG Intergenic
No off target data available for this crispr