ID: 1025929804

View in Genome Browser
Species Human (GRCh38)
Location 7:65984411-65984433
Sequence AGGAGTGGCAAGATCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025929804_1025929809 -7 Left 1025929804 7:65984411-65984433 CCTTCCAGGATCTTGCCACTCCT No data
Right 1025929809 7:65984427-65984449 CACTCCTGATTCCTTAGCTGGGG No data
1025929804_1025929806 -9 Left 1025929804 7:65984411-65984433 CCTTCCAGGATCTTGCCACTCCT No data
Right 1025929806 7:65984425-65984447 GCCACTCCTGATTCCTTAGCTGG No data
1025929804_1025929808 -8 Left 1025929804 7:65984411-65984433 CCTTCCAGGATCTTGCCACTCCT No data
Right 1025929808 7:65984426-65984448 CCACTCCTGATTCCTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025929804 Original CRISPR AGGAGTGGCAAGATCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr