ID: 1025935584

View in Genome Browser
Species Human (GRCh38)
Location 7:66033538-66033560
Sequence ACTCCTGGTTTAAGACATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025935584_1025935586 22 Left 1025935584 7:66033538-66033560 CCTGTATGTCTTAAACCAGGAGT No data
Right 1025935586 7:66033583-66033605 GACCCAAGATTTCAAAAGCATGG No data
1025935584_1025935587 23 Left 1025935584 7:66033538-66033560 CCTGTATGTCTTAAACCAGGAGT No data
Right 1025935587 7:66033584-66033606 ACCCAAGATTTCAAAAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025935584 Original CRISPR ACTCCTGGTTTAAGACATAC AGG (reversed) Intergenic
No off target data available for this crispr