ID: 1025952152

View in Genome Browser
Species Human (GRCh38)
Location 7:66153723-66153745
Sequence GATTTCAGCTGAAGCTCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025952152_1025952156 12 Left 1025952152 7:66153723-66153745 CCATCTGAGCTTCAGCTGAAATC 0: 1
1: 0
2: 3
3: 29
4: 217
Right 1025952156 7:66153758-66153780 ACATTGAAAGTACCAGATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 150
1025952152_1025952154 10 Left 1025952152 7:66153723-66153745 CCATCTGAGCTTCAGCTGAAATC 0: 1
1: 0
2: 3
3: 29
4: 217
Right 1025952154 7:66153756-66153778 CAACATTGAAAGTACCAGATTGG 0: 1
1: 0
2: 0
3: 8
4: 140
1025952152_1025952159 25 Left 1025952152 7:66153723-66153745 CCATCTGAGCTTCAGCTGAAATC 0: 1
1: 0
2: 3
3: 29
4: 217
Right 1025952159 7:66153771-66153793 CAGATTGGGGCCAGGTGTAGCGG 0: 1
1: 1
2: 33
3: 297
4: 2181
1025952152_1025952157 17 Left 1025952152 7:66153723-66153745 CCATCTGAGCTTCAGCTGAAATC 0: 1
1: 0
2: 3
3: 29
4: 217
Right 1025952157 7:66153763-66153785 GAAAGTACCAGATTGGGGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 244
1025952152_1025952155 11 Left 1025952152 7:66153723-66153745 CCATCTGAGCTTCAGCTGAAATC 0: 1
1: 0
2: 3
3: 29
4: 217
Right 1025952155 7:66153757-66153779 AACATTGAAAGTACCAGATTGGG 0: 1
1: 0
2: 1
3: 17
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025952152 Original CRISPR GATTTCAGCTGAAGCTCAGA TGG (reversed) Exonic
900542266 1:3209061-3209083 GAATTCAGAAGGAGCTCAGAAGG + Intronic
903015850 1:20361482-20361504 GATTCTAGGTGATGCTCAGATGG - Intergenic
903135722 1:21308187-21308209 CATTTCAGCTGAGACTCAAAAGG - Intronic
903270331 1:22184283-22184305 GATTTCAGTTCAACCTCAGAAGG - Intergenic
904535987 1:31199664-31199686 CATTTCAACTCATGCTCAGATGG - Intronic
905056908 1:35103050-35103072 GATTTCTGCTAAGGCTCTGACGG + Intronic
906716093 1:47970451-47970473 GATTTCAGCTAGATCTTAGAAGG - Intronic
906730930 1:48080493-48080515 GATTTCATAAGAAGCCCAGAAGG - Intergenic
907723697 1:56998905-56998927 GACTTCAGCTGATGTTGAGATGG + Intronic
908040032 1:60102574-60102596 CCATTCAGCTGAAGCTGAGATGG - Intergenic
910621309 1:89258505-89258527 GATTTGAACTGAAGTTCAGAAGG - Intergenic
911722406 1:101205736-101205758 GATTTTAGCAGCAGATCAGAAGG + Intergenic
912117903 1:106429712-106429734 GATTTTAGCTGAAGATCATGTGG - Intergenic
912900854 1:113646597-113646619 GATTTCAGGTAGACCTCAGAAGG - Exonic
913025485 1:114833722-114833744 GAATTCAGCTGAAGGGCATAGGG + Intergenic
915034232 1:152909126-152909148 GACTGCAGCTAAACCTCAGAAGG + Intronic
916648945 1:166817000-166817022 AATTTCAGCTGCACCCCAGAGGG + Intergenic
918208750 1:182332396-182332418 GAGTTCTGCTGGAGCTCTGATGG - Intergenic
919633714 1:199983639-199983661 GAGTTCAGCTGAAGCATAAAGGG - Intergenic
920647256 1:207812751-207812773 GAATTCAGATGATGGTCAGAGGG - Intergenic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
923464612 1:234237050-234237072 AAATTCAGCTGAAGGCCAGATGG + Intronic
1062900247 10:1138462-1138484 GCTTTCAGCTGAAGATGAGAAGG + Intergenic
1064113459 10:12557982-12558004 GATATTAAATGAAGCTCAGAGGG + Intronic
1064298307 10:14098968-14098990 GTTTTCAGATGAAGAACAGAAGG - Intronic
1066249600 10:33619744-33619766 AAGTTCAGCTAATGCTCAGAAGG + Intergenic
1069290473 10:66772770-66772792 CATTTCAGCTTCAGTTCAGAGGG - Intronic
1074115971 10:110457763-110457785 GATTCCAGGTGAACCTCGGAAGG + Intergenic
1076868076 10:133179120-133179142 GATTCCACCTGAAGCTCAGAAGG + Intronic
1079030557 11:16983202-16983224 GATTTCAGCTCAACCTGAAATGG + Intronic
1080360826 11:31511255-31511277 GATATCAACTGAGGCTCACAAGG - Intronic
1081254741 11:40878421-40878443 GATCTCAGGTGGAGCTAAGACGG - Intronic
1082014242 11:47472433-47472455 GATTTGAGATGAAGCACATAAGG - Intronic
1084664117 11:70567048-70567070 GCATTCAGCAGCAGCTCAGAGGG - Intronic
1085561623 11:77477140-77477162 GATTTCAGCTGCAGCTTTGGTGG - Intergenic
1085610740 11:77946226-77946248 GATTACAGCTGAAGCTGACAAGG + Intronic
1088886628 11:114012767-114012789 GATTTCAGCTCCAGCCCAGCTGG - Intergenic
1088924439 11:114285963-114285985 GATGTCATCTGAGGCACAGAAGG + Intronic
1092397826 12:8144005-8144027 CATTTCAGCTCAGGCACAGAGGG - Intronic
1092836541 12:12494594-12494616 ATTGTCAGCTGAAGCTCAGATGG + Intronic
1093646769 12:21595170-21595192 GATTGCAGCTCCAACTCAGATGG + Intronic
1093898140 12:24599314-24599336 GATTTTCTCTGAAGCTCAGCAGG + Intergenic
1096055478 12:48647575-48647597 GATTTAATCAGAATCTCAGAGGG + Intergenic
1096160215 12:49370167-49370189 TTTTTCAGATGAGGCTCAGAAGG + Intronic
1100203737 12:92326234-92326256 GATTGCAGCTCCAACTCAGATGG - Intergenic
1102454895 12:113065282-113065304 TAGTAAAGCTGAAGCTCAGAGGG + Intronic
1103216381 12:119204765-119204787 GAATTCAGCTGAGGCTCAGCTGG + Intronic
1103438736 12:120947330-120947352 GATTGCAGCTGGAGCAGAGACGG + Intergenic
1104149480 12:126068981-126069003 GGATTTAACTGAAGCTCAGAGGG - Intergenic
1105633080 13:22190934-22190956 TATTTCAGCTGAAGACCTGATGG + Intergenic
1106390026 13:29326164-29326186 GATTGCAGCTCCAGCTCTGAGGG + Intronic
1108276498 13:48815663-48815685 AAATACAGCTGAAGCTCATATGG + Intergenic
1109881309 13:68481000-68481022 GATTACAGATGAGGCACAGAGGG - Intergenic
1110747958 13:79078754-79078776 GATTTCAGCTCCCACTCAGATGG + Intergenic
1113418588 13:110151854-110151876 AAATTCAGCTGAAACTGAGAGGG - Intronic
1115348014 14:32363851-32363873 CTTTTTAGTTGAAGCTCAGATGG - Intronic
1117915962 14:60678122-60678144 CATCCCAGCTGAAGCACAGATGG - Intergenic
1118046275 14:61974823-61974845 GTGCTCAGCTGGAGCTCAGAAGG + Intergenic
1119133753 14:72197718-72197740 GTTTTCAGCTGGAGGTCAGCTGG + Intronic
1119946628 14:78701969-78701991 GATGTCAGCTGTATCTCAGCAGG + Intronic
1120638005 14:86974956-86974978 GAACTCAGCTGAGGCTGAGAAGG + Intergenic
1120934649 14:89882801-89882823 AATTTCAGCTGGAGGTCTGAGGG - Intronic
1120999134 14:90438745-90438767 AATCTCAGCTGAAATTCAGAGGG - Intergenic
1121041926 14:90756801-90756823 GAGTCCAGAGGAAGCTCAGAGGG - Intronic
1121310020 14:92930680-92930702 GAGTCCTGGTGAAGCTCAGATGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1125530067 15:40407265-40407287 GAATGCAGCTGGAGCACAGAGGG + Intronic
1126963918 15:54029806-54029828 GATTTCAGCTGCAGCTCCGGTGG + Intronic
1128140893 15:65300318-65300340 GAATGCATCTGAAGGTCAGAAGG - Intronic
1130232876 15:82109886-82109908 GGGTGCATCTGAAGCTCAGAAGG + Intergenic
1131316096 15:91338980-91339002 GATTTCAGCCAAAGCTCTGCTGG - Intergenic
1133639540 16:7703380-7703402 GCTCTCAGATGAAGTTCAGAAGG - Intronic
1134646755 16:15874768-15874790 GAGTTCAGCTCACACTCAGAGGG - Intronic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1135042654 16:19129897-19129919 GAATTCAGCTGAGGGGCAGAAGG - Intronic
1135218669 16:20594149-20594171 GATTTTATCTCAAACTCAGATGG - Intergenic
1138302872 16:55947222-55947244 AATTTCAGCAAAAGATCAGATGG + Intronic
1139086478 16:63592504-63592526 TGTTTCAGGTGAACCTCAGAAGG + Intergenic
1139348238 16:66318340-66318362 GAATACAGCTGGACCTCAGAAGG - Intergenic
1139476846 16:67207079-67207101 CACTTCAGCTGAAGCTGGGAGGG + Intergenic
1139638396 16:68273409-68273431 GATTTCTTCTGAAGATGAGATGG + Intronic
1143058072 17:4177350-4177372 GCTTGCAGATGAAGCTCAGGAGG - Intronic
1143256046 17:5558829-5558851 GAATGAAGCTGTAGCTCAGAGGG + Exonic
1144305892 17:13969355-13969377 AATTTCAGCTGGAGGTCAGGGGG - Intergenic
1149531780 17:57401612-57401634 AAATTCAGCAGAAGCTGAGATGG + Intronic
1152612719 17:81323495-81323517 GAGGTCAGCTGGAGGTCAGAAGG + Intronic
1154382955 18:13869106-13869128 GTTTTCAGCTGGAGAGCAGACGG + Intergenic
1156761711 18:40599865-40599887 GATTGCATTTGGAGCTCAGACGG - Intergenic
1158059919 18:53327773-53327795 GATTTCACTTGATGCTCATATGG + Intronic
1158602537 18:58867064-58867086 GATGTCAACTAAAACTCAGATGG + Intronic
1159228446 18:65572359-65572381 GATCTCAGCACATGCTCAGATGG + Intergenic
1159963426 18:74573681-74573703 GATTTCAGATGCAGTTCATAGGG - Intronic
1166604404 19:44127519-44127541 GATTGCAGCTCCAACTCAGACGG - Intronic
925933045 2:8725976-8725998 GACTGCAGCTGAAGCTCCGCAGG + Intronic
926880658 2:17540455-17540477 GATTTTAGCAAAAGCTCAAAAGG - Intronic
926909093 2:17833215-17833237 CACTTCAGCTTGAGCTCAGAGGG - Intergenic
927146641 2:20170577-20170599 GATTTCATCAGATGCTCCGAGGG - Intergenic
928722908 2:34141107-34141129 GATTGCAGAGGAAGCCCAGAAGG - Intergenic
928746946 2:34426525-34426547 AATTCCAGCTGAAGCGAAGATGG - Intergenic
929805865 2:45144701-45144723 GATTGCAGCTCCAACTCAGAGGG + Intergenic
931673882 2:64673728-64673750 GATTGCAGCTGAATCTCCCAGGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933477047 2:82803997-82804019 GAATTGAGCTGAAGCTGAGATGG + Intergenic
935558515 2:104537221-104537243 AATGTCAGTTGAAGCTCGGAAGG + Intergenic
938104504 2:128520812-128520834 GGTGACAGCTGAGGCTCAGAAGG - Intergenic
940265232 2:151828866-151828888 GACTTCAGCTGAGTGTCAGAGGG - Intergenic
940343847 2:152609088-152609110 AATTTCAGCAGAAACTCAAATGG - Intronic
942887237 2:180940329-180940351 GATTTCAGCTGAAGCTATGAGGG - Intergenic
942983648 2:182112713-182112735 GTTTTCAGCAGAATCTCAGTGGG - Intronic
943010538 2:182443060-182443082 GAATTCAGGTAAACCTCAGAAGG - Intronic
943230865 2:185249578-185249600 AAATTGAGCAGAAGCTCAGAAGG + Intergenic
943810086 2:192174571-192174593 GATTTCAATTGAAGTTCAGATGG + Intronic
946188553 2:217995366-217995388 GACATCATCTGAAGTTCAGAAGG + Intronic
947685283 2:232078415-232078437 GCTTTCATCTGATTCTCAGAGGG + Intronic
947808059 2:232982112-232982134 GATTTCAGCTTCAGCCCAGCAGG + Intronic
948749591 2:240124107-240124129 GTTTGCAGCTGAAGCAGAGAAGG - Intergenic
1170341736 20:15336241-15336263 GCTTTTAGATGAAGCTCAGTAGG + Intronic
1171377697 20:24704752-24704774 AATTTGAGCTGGAGCTCAGCTGG + Intergenic
1171909053 20:30924324-30924346 GAATTCAACTGAAGTTCATATGG - Intergenic
1172938203 20:38636004-38636026 GGTGACAGCAGAAGCTCAGAGGG + Intronic
1173145747 20:40522629-40522651 GATTTCAGCTGAAACCATGAAGG + Intergenic
1175083783 20:56442699-56442721 GATTTCAGTTTAAATTCAGAAGG + Intronic
1175343863 20:58255554-58255576 GATTTCAGCTTCTGCTCACAAGG + Intergenic
1175883135 20:62271938-62271960 GATGGCAGCTGAGGCTCACAGGG + Intronic
1176205172 20:63884270-63884292 GAGTTCAGCTGAAACTCAGGGGG - Intronic
1177303780 21:19285853-19285875 GATTTTAGTTAAAGCTCAGCAGG + Intergenic
1177993580 21:28068482-28068504 GATTTGAGCTGAAGCTCAAATGG + Intergenic
1179932059 21:44577404-44577426 GACCTCAGCAGAAGCTCAGCAGG - Intronic
1180066857 21:45416648-45416670 GATTCCAGCTTAGGCTCAGCAGG + Intronic
1183804625 22:40197691-40197713 GATCTCAGCTTGAGCCCAGAAGG - Intronic
1185179687 22:49352036-49352058 GAAGTCAGCTGGAGCTCAGGCGG - Intergenic
949426965 3:3928237-3928259 GATTTCAGCTGCAGCTGTGATGG - Intronic
950361286 3:12451117-12451139 GATTTCAGCCACAGCTGAGATGG - Intergenic
953078863 3:39596868-39596890 GATTTCAGCTGCTGCTATGAAGG + Intergenic
953703812 3:45216378-45216400 GATTTCAGATGAGGCTGATAAGG - Intergenic
953993097 3:47498956-47498978 CATGTGAGCTGAATCTCAGAGGG + Intronic
955248744 3:57255290-57255312 GATTTCAGCTGAGGCTGGGAGGG + Intronic
955662472 3:61316038-61316060 GATTTCAGCTGCAGCTGTGGTGG + Intergenic
956684477 3:71812032-71812054 GATTTCAGTGGAAGTTAAGATGG + Intergenic
958131018 3:89422992-89423014 AATTTTAGCTGAAGTTCAAAAGG + Intronic
959054632 3:101555007-101555029 GATTTCAACTGAGGAGCAGAAGG - Intergenic
960377075 3:116916141-116916163 GATTTCAGTTGAGTCTAAGAAGG + Intronic
963193018 3:142494665-142494687 GATTTTAGCTGAAGTTTAAAGGG + Intronic
963798062 3:149650885-149650907 GATTACAGCTGTAGCTTTGAGGG - Intronic
967091136 3:186135709-186135731 GATTACAGCTGAATAACAGATGG - Intronic
967375093 3:188792272-188792294 GATTGGAGCTGAAACTAAGAAGG - Intronic
968041931 3:195596059-195596081 GGCTTCAGCTGAGGCTCTGAGGG + Intergenic
968125622 3:196157931-196157953 GATTGCAGCTGTGACTCAGATGG - Intergenic
970001841 4:11372607-11372629 GAATCCAGATGAAGCTGAGAAGG + Intergenic
970164196 4:13219061-13219083 GCTTTCAGCTGAAACACAGAAGG + Intergenic
970311938 4:14792314-14792336 GATTGCAGCTCCAACTCAGATGG + Intergenic
970480093 4:16463898-16463920 AATTTCATCTGAATCTCAGAAGG + Intergenic
973218763 4:47701397-47701419 AATTTAAGCTGAAGGCCAGATGG - Intronic
975619609 4:76282804-76282826 GATTTCAACTGAAGGAGAGAAGG + Intronic
975736703 4:77388345-77388367 GATTCCATCTGGAGCTCAGTAGG - Intronic
977976185 4:103269282-103269304 GCTTGCAGCTCCAGCTCAGATGG - Intergenic
978202025 4:106033285-106033307 GCTTGCAGCTCCAGCTCAGATGG - Intergenic
979396380 4:120194397-120194419 CATGTTAGCTGCAGCTCAGAGGG - Intergenic
980717894 4:136652056-136652078 TATTTAAGCTGAAGCACAGTGGG + Intergenic
981167565 4:141580399-141580421 GCTTGCAGCTACAGCTCAGATGG + Intergenic
982119566 4:152128895-152128917 GATTGCAGCTCCAACTCAGATGG - Intergenic
982456609 4:155617735-155617757 AATTTCTGCTGAAGTTCAGTGGG - Intergenic
986728840 5:10619946-10619968 GATTTGAGCTGGGGCTGAGAGGG + Intronic
986839221 5:11676707-11676729 GTTTTCAACTCAAGGTCAGAAGG + Intronic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
988629673 5:32915311-32915333 GAATTCAGCTGAGGGGCAGAAGG - Intergenic
989098995 5:37807346-37807368 CATCTCAGCTCAAGCTCAGGGGG + Intergenic
989721599 5:44535232-44535254 GAGTTCACCTGTAGCTAAGATGG - Intergenic
990140070 5:52693095-52693117 GTTTTCAGGTGTTGCTCAGAAGG - Intergenic
991247084 5:64520030-64520052 GATTTTAGGTGAAGCTCACTTGG + Intronic
992192638 5:74309001-74309023 GTTTTCAGCAAAACCTCAGAGGG - Intergenic
992520191 5:77542767-77542789 GATTTCAGCTCCAACTCGGATGG + Intronic
993193321 5:84705941-84705963 TATTTCAGTTGATGCTGAGAGGG + Intergenic
993415782 5:87628358-87628380 GACTTCATCTGAAGCACTGATGG - Intergenic
993507949 5:88734225-88734247 GCTGTCAGCTGAAGGTCAGATGG + Intronic
993514878 5:88819058-88819080 GGGTACTGCTGAAGCTCAGAGGG + Intronic
993522815 5:88924909-88924931 GTATTTAGCTGAAGCTAAGAGGG - Intergenic
995830922 5:116355020-116355042 GGTTTAAGATGAATCTCAGAAGG + Intronic
998777627 5:145619683-145619705 GATTGCAGCTCCAACTCAGATGG - Intronic
1000408797 5:160916788-160916810 GATTACAGCTGAGGCTCAAGGGG + Intergenic
1001902437 5:175443507-175443529 ATTTTCAGCTGAGTCTCAGAAGG - Exonic
1003291507 6:4782706-4782728 GCTTTCATCTGATTCTCAGAGGG + Intronic
1003339375 6:5204959-5204981 GAGTTCCGCTGAAACTCAGAAGG - Intronic
1003729330 6:8803500-8803522 GATTTCAGCCAAAGCTATGAAGG + Intergenic
1005706035 6:28454502-28454524 GAATACATATGAAGCTCAGATGG - Intergenic
1008429510 6:51398969-51398991 ATTGTCAGCTGAAGCTCAAATGG - Intergenic
1011916171 6:92509270-92509292 GAACTGAGCTGAAGCTGAGATGG + Intergenic
1012967794 6:105694088-105694110 CAGTTCAGCTGAAGATCACAAGG + Intergenic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1015531484 6:134225640-134225662 TATCTCAGCTGATCCTCAGAAGG + Intronic
1015853987 6:137603990-137604012 GATTCCAGCTGAAGCCCTGATGG - Intergenic
1016384819 6:143520259-143520281 AATTACAGCTGACACTCAGAGGG + Intergenic
1016943730 6:149507891-149507913 GATTTCAGATGAGCCTCAAAGGG + Intronic
1017116636 6:150983601-150983623 CATGTCAGGTGAAGCTCAGAAGG - Intronic
1018315068 6:162548687-162548709 CATTGCAGCTCAAGCTCAAATGG - Intronic
1019647313 7:2137989-2138011 GATGGCAGCTGAAGTTCACAGGG + Intronic
1021096443 7:16540590-16540612 GATTTCAGATGAGACTCAGGTGG - Intronic
1023534623 7:41195128-41195150 GATGTCAGCTGCAGATGAGAAGG + Intergenic
1024064572 7:45721720-45721742 GATTTCAGCAGGAGTTCAGAGGG + Exonic
1024447644 7:49500052-49500074 GATTACAGCTGAAGGTCTGTGGG + Intergenic
1024645661 7:51368476-51368498 GACTTCGCCTGAGGCTCAGATGG - Intergenic
1025842365 7:65162828-65162850 GATTACAGCTGAAGCTGACAAGG - Intergenic
1025880679 7:65533142-65533164 GATTACAGCTGAAGCTGACAAGG + Intergenic
1025892758 7:65669462-65669484 GATTACAGCTGAAGCTGACAAGG - Intergenic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1026207882 7:68273961-68273983 GCTTTCAGCTGCACCTCAGCTGG - Intergenic
1026878158 7:73891581-73891603 GGTTTCAGCAGAAGCTGAGTAGG - Intergenic
1028604545 7:92641733-92641755 CATCTCAGGTGGAGCTCAGAAGG - Intronic
1031986060 7:128165573-128165595 GATTTTGGCTGCAGCTCAGTGGG + Intergenic
1033989338 7:147264846-147264868 TATTTGAGGTGAAGCTCAAAAGG + Intronic
1034278343 7:149834256-149834278 GATTTCAGCTGCAGCTGTGGAGG + Intergenic
1034452423 7:151144109-151144131 GATTTGAGCTGCAGCAGAGAGGG + Exonic
1036755891 8:11470922-11470944 GATTCAGGCTGAAGTTCAGAAGG + Intronic
1037713614 8:21376665-21376687 GATTGCAGCTGTGACTCAGATGG - Intergenic
1041482109 8:58332853-58332875 GAACTGAGCTGAAGCTGAGATGG + Intergenic
1043545052 8:81306225-81306247 GCTTGCAGCTGTTGCTCAGATGG + Intergenic
1045834380 8:106503308-106503330 TATTTCAGCTAAAACTGAGAAGG + Intronic
1047237438 8:123054248-123054270 GCATTCAGCTGAAGCTCAGCTGG - Intronic
1047626950 8:126666192-126666214 GAATTCACCTGAAGCTCTGGTGG + Intergenic
1052096933 9:24394696-24394718 GATTTTAGATGAAGCACAAAAGG - Intergenic
1053185270 9:36010960-36010982 GATTTCAGCTCAATATCACAGGG + Intergenic
1053228521 9:36384331-36384353 GTAAACAGCTGAAGCTCAGAGGG + Intronic
1054821516 9:69525924-69525946 GACTTCGACTGAAGATCAGATGG - Intronic
1055885421 9:81057286-81057308 GGCTTCAGCTGGAGCTCAGCTGG - Intergenic
1058643347 9:107108134-107108156 GACTGCAGCTGAATTTCAGAAGG + Intergenic
1059460354 9:114425701-114425723 GATTTCTGATGAAGATCAAAAGG + Intronic
1062467766 9:136688644-136688666 GATTCCAGATGAAGCCCATATGG - Intergenic
1062469396 9:136695915-136695937 GGTTTCACCTAAAGCTCAGACGG - Intergenic
1187004638 X:15220023-15220045 GATTTCAGCTGCTGCTGAGGTGG - Intergenic
1187005096 X:15224943-15224965 GATTTCAGCTGCTGCTGAGATGG - Intergenic
1188409746 X:29857071-29857093 TATTTCAAGTGAAGCTGAGAGGG - Intronic
1188453485 X:30335065-30335087 GAGTTCACCTGAAGTGCAGATGG - Intergenic
1191807013 X:65146991-65147013 GATTTCAGCTTCAACTCGGATGG - Intergenic
1193657804 X:84219977-84219999 GATTTCAGGTGAAAATCCGATGG - Intergenic
1194499158 X:94658709-94658731 GACTTCAGCTGAGGCTAAAAGGG + Intergenic
1194890332 X:99371341-99371363 GAACACAGCTGAAGGTCAGAAGG - Intergenic
1196580994 X:117378970-117378992 TGTTTCATCTGAAGCACAGATGG + Intergenic
1196728230 X:118916353-118916375 TAATGCAGCTGAAGCTCAAATGG + Intergenic
1196756728 X:119163947-119163969 GATTTCTGCTCAATTTCAGAAGG + Intergenic
1197123858 X:122921672-122921694 GATTTTTGCTGAAGATCAGATGG + Intergenic
1198391199 X:136176332-136176354 GAATACAGCTGAAGGTGAGAGGG - Intronic
1198620816 X:138507468-138507490 GATTACTATTGAAGCTCAGATGG + Intergenic
1198659816 X:138955998-138956020 TACTTCAGCTGAGGCTCAGTTGG + Intronic
1198725992 X:139677450-139677472 GAATTCAACTGAAGGTCATAAGG - Intronic
1199157178 X:144563991-144564013 TATTTCAGCTGAAAATCTGAAGG + Intergenic
1200296817 X:154928332-154928354 GATTTCCCCTGCAGCTCATAAGG + Intronic
1200467992 Y:3545450-3545472 GATATCAGCTTAAACACAGAAGG - Intergenic
1200961496 Y:9000403-9000425 GATTTCAGGAGAAGCCAAGAGGG - Intergenic
1201066551 Y:10101456-10101478 GATAACAGATGAAGCTCAGGTGG - Intergenic
1201334580 Y:12866707-12866729 GATTTCAGATGAGGGTAAGAAGG - Intergenic