ID: 1025963969

View in Genome Browser
Species Human (GRCh38)
Location 7:66250585-66250607
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963969_1025963973 -6 Left 1025963969 7:66250585-66250607 CCCCCTTATCTGCAGATGATATG No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963969_1025963978 16 Left 1025963969 7:66250585-66250607 CCCCCTTATCTGCAGATGATATG No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963969 Original CRISPR CATATCATCTGCAGATAAGG GGG (reversed) Intronic