ID: 1025963970

View in Genome Browser
Species Human (GRCh38)
Location 7:66250586-66250608
Sequence ACATATCATCTGCAGATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 1, 2: 20, 3: 89, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963970_1025963973 -7 Left 1025963970 7:66250586-66250608 CCCCTTATCTGCAGATGATATGT 0: 1
1: 1
2: 20
3: 89
4: 292
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963970_1025963978 15 Left 1025963970 7:66250586-66250608 CCCCTTATCTGCAGATGATATGT 0: 1
1: 1
2: 20
3: 89
4: 292
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963970 Original CRISPR ACATATCATCTGCAGATAAG GGG (reversed) Intronic