ID: 1025963971

View in Genome Browser
Species Human (GRCh38)
Location 7:66250587-66250609
Sequence AACATATCATCTGCAGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963971_1025963973 -8 Left 1025963971 7:66250587-66250609 CCCTTATCTGCAGATGATATGTT No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963971_1025963978 14 Left 1025963971 7:66250587-66250609 CCCTTATCTGCAGATGATATGTT No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963971 Original CRISPR AACATATCATCTGCAGATAA GGG (reversed) Intronic