ID: 1025963972

View in Genome Browser
Species Human (GRCh38)
Location 7:66250588-66250610
Sequence GAACATATCATCTGCAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963972_1025963973 -9 Left 1025963972 7:66250588-66250610 CCTTATCTGCAGATGATATGTTC No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963972_1025963978 13 Left 1025963972 7:66250588-66250610 CCTTATCTGCAGATGATATGTTC No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963972 Original CRISPR GAACATATCATCTGCAGATA AGG (reversed) Intronic