ID: 1025963972 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:66250588-66250610 |
Sequence | GAACATATCATCTGCAGATA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1025963972_1025963973 | -9 | Left | 1025963972 | 7:66250588-66250610 | CCTTATCTGCAGATGATATGTTC | No data | ||
Right | 1025963973 | 7:66250602-66250624 | GATATGTTCCAAGACCCCAGTGG | No data | ||||
1025963972_1025963978 | 13 | Left | 1025963972 | 7:66250588-66250610 | CCTTATCTGCAGATGATATGTTC | No data | ||
Right | 1025963978 | 7:66250624-66250646 | GATGCCCGAAACCCCACTGATGG | 0: 1 1: 0 2: 0 3: 6 4: 69 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1025963972 | Original CRISPR | GAACATATCATCTGCAGATA AGG (reversed) | Intronic | ||