ID: 1025963973

View in Genome Browser
Species Human (GRCh38)
Location 7:66250602-66250624
Sequence GATATGTTCCAAGACCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963971_1025963973 -8 Left 1025963971 7:66250587-66250609 CCCTTATCTGCAGATGATATGTT No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963968_1025963973 24 Left 1025963968 7:66250555-66250577 CCTGGAAATGGGAATGATAATAT No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963972_1025963973 -9 Left 1025963972 7:66250588-66250610 CCTTATCTGCAGATGATATGTTC No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963969_1025963973 -6 Left 1025963969 7:66250585-66250607 CCCCCTTATCTGCAGATGATATG No data
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data
1025963970_1025963973 -7 Left 1025963970 7:66250586-66250608 CCCCTTATCTGCAGATGATATGT 0: 1
1: 1
2: 20
3: 89
4: 292
Right 1025963973 7:66250602-66250624 GATATGTTCCAAGACCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963973 Original CRISPR GATATGTTCCAAGACCCCAG TGG Intronic