ID: 1025963974

View in Genome Browser
Species Human (GRCh38)
Location 7:66250610-66250632
Sequence TCGGGCATCCACTGGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963974_1025963978 -9 Left 1025963974 7:66250610-66250632 CCAAGACCCCAGTGGATGCCCGA No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963974 Original CRISPR TCGGGCATCCACTGGGGTCT TGG (reversed) Intronic