ID: 1025963974 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:66250610-66250632 |
| Sequence | TCGGGCATCCACTGGGGTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1025963974_1025963978 | -9 | Left | 1025963974 | 7:66250610-66250632 | CCAAGACCCCAGTGGATGCCCGA | No data | ||
| Right | 1025963978 | 7:66250624-66250646 | GATGCCCGAAACCCCACTGATGG | 0: 1 1: 0 2: 0 3: 6 4: 69 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1025963974 | Original CRISPR | TCGGGCATCCACTGGGGTCT TGG (reversed) | Intronic | ||