ID: 1025963978

View in Genome Browser
Species Human (GRCh38)
Location 7:66250624-66250646
Sequence GATGCCCGAAACCCCACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025963972_1025963978 13 Left 1025963972 7:66250588-66250610 CCTTATCTGCAGATGATATGTTC No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69
1025963974_1025963978 -9 Left 1025963974 7:66250610-66250632 CCAAGACCCCAGTGGATGCCCGA No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69
1025963971_1025963978 14 Left 1025963971 7:66250587-66250609 CCCTTATCTGCAGATGATATGTT No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69
1025963970_1025963978 15 Left 1025963970 7:66250586-66250608 CCCCTTATCTGCAGATGATATGT 0: 1
1: 1
2: 20
3: 89
4: 292
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69
1025963969_1025963978 16 Left 1025963969 7:66250585-66250607 CCCCCTTATCTGCAGATGATATG No data
Right 1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025963978 Original CRISPR GATGCCCGAAACCCCACTGA TGG Intronic