ID: 1025969551

View in Genome Browser
Species Human (GRCh38)
Location 7:66309502-66309524
Sequence AACCTGCTGTGACCCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025969551_1025969555 -9 Left 1025969551 7:66309502-66309524 CCCTCTGAGGGTCACAGCAGGTT 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1025969555 7:66309516-66309538 CAGCAGGTTGGTTCAGGAGTAGG No data
1025969551_1025969558 19 Left 1025969551 7:66309502-66309524 CCCTCTGAGGGTCACAGCAGGTT 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1025969558 7:66309544-66309566 GACCCAACACAGGCAAATAAAGG 0: 1
1: 0
2: 2
3: 14
4: 130
1025969551_1025969561 30 Left 1025969551 7:66309502-66309524 CCCTCTGAGGGTCACAGCAGGTT 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1025969561 7:66309555-66309577 GGCAAATAAAGGTCTTTCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 163
1025969551_1025969556 9 Left 1025969551 7:66309502-66309524 CCCTCTGAGGGTCACAGCAGGTT 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1025969556 7:66309534-66309556 GTAGGAACCTGACCCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025969551 Original CRISPR AACCTGCTGTGACCCTCAGA GGG (reversed) Intronic
900410849 1:2511981-2512003 AACATGCTGCGATCCGCAGAAGG + Intronic
903449191 1:23441399-23441421 AAGCTGCAGTGTCCCTCGGAGGG + Exonic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
907399527 1:54216393-54216415 TACCTGGTGTGAGCCTCAGGTGG + Intronic
917788545 1:178485271-178485293 CACCTGCTGTAAACCTCTGATGG + Intergenic
917952387 1:180053062-180053084 AATCTGCGGTGACTCTCTGAAGG - Exonic
920818652 1:209359731-209359753 AACCTGTTGTCAACCTCACAGGG - Intergenic
920824723 1:209414641-209414663 AACCAGCTGTTAGCCTCACAGGG + Intergenic
921103027 1:211947652-211947674 AAGCGGCTGGGACCCTCAGCTGG - Intronic
921339125 1:214116912-214116934 AAACTACTGTGACCCTCAGCTGG + Intergenic
921723263 1:218496803-218496825 ATCCTGCTGGTAACCTCAGAAGG + Intergenic
922194911 1:223351544-223351566 AACCTCCTGTGACTCTCAGATGG - Intronic
923042319 1:230327939-230327961 AGCCTCCTGTGACCCAGAGAAGG - Intronic
1066683038 10:37953921-37953943 AAACTGCTGTCACACACAGAAGG + Intronic
1067069229 10:43119998-43120020 AGCCTGGTGTGACCAGCAGAGGG - Intronic
1067471042 10:46537938-46537960 AAAATGCTGTGTCCCTGAGAAGG + Intergenic
1067537758 10:47127189-47127211 CGCCTGCTGTGGCCATCAGAAGG - Intergenic
1067894348 10:50162908-50162930 AAGCTGCTGTGGCCTTGAGAGGG - Intergenic
1067954492 10:50777353-50777375 AAGCTGCTGTGGCCTTGAGAGGG + Intronic
1069662185 10:70131339-70131361 ATCCTGCTGTGTCCCGCAGGTGG - Intronic
1074480078 10:113811509-113811531 AAGCTGGTGTGACCCACAGAGGG + Intergenic
1076462088 10:130654698-130654720 AACTTGCAGGGGCCCTCAGAGGG + Intergenic
1076818330 10:132925486-132925508 CACCTGCTGAGGACCTCAGAGGG - Intronic
1077170437 11:1163681-1163703 ATGCTGCTGGGACCCTCAGGGGG - Intronic
1082763029 11:57145054-57145076 GGCCTCCAGTGACCCTCAGAGGG - Intergenic
1085781100 11:79409871-79409893 TTCCTGCTGGGACCCTCAGAGGG - Intronic
1086482033 11:87251714-87251736 AAGCTGCTGTGACTCACTGATGG + Intronic
1090423831 11:126593492-126593514 AACCTGCTGTGACCCCCTCTGGG + Intronic
1091948144 12:4567779-4567801 GACCTCATGTGACCATCAGAAGG + Intronic
1092732716 12:11549307-11549329 AGCCTGCTGTCACCATGAGAGGG - Intergenic
1092780793 12:11984928-11984950 AACCTGCAGAGACGCTCACATGG + Intergenic
1096689221 12:53309196-53309218 AACCTGCTCTGGTCCCCAGACGG - Exonic
1100055540 12:90504514-90504536 AACCTGCTGTTGCCATCAAATGG + Intergenic
1103917751 12:124384694-124384716 AACCTGCTGAGGCCCAGAGAGGG - Intronic
1104131953 12:125902570-125902592 AACCAGCAATGACCATCAGAGGG + Intergenic
1104688327 12:130805348-130805370 AGCCTGCTGCTGCCCTCAGACGG + Intronic
1106524536 13:30528289-30528311 AACCAACTGGGACCATCAGAGGG + Intronic
1108148436 13:47504543-47504565 ACCCTGCTGTGACCCTTTCAAGG - Intergenic
1112564934 13:100544992-100545014 CTCCTGGTGTGACACTCAGAAGG + Intronic
1113226854 13:108168788-108168810 AAACTGCTTTCACCCTCAGTCGG - Intergenic
1113655530 13:112066346-112066368 AACCTGCAGGGGCCCTCGGAGGG + Intergenic
1115570905 14:34665369-34665391 GACCTGTAGTGACCCTAAGAGGG - Intergenic
1117292790 14:54349768-54349790 AACCTGCTGTGACCTTTGGAAGG + Intergenic
1122005516 14:98700268-98700290 AAGCTGGTGTGACCCTTTGATGG + Intergenic
1123727882 15:23123110-23123132 AAAGTCCTGTGAACCTCAGATGG - Intergenic
1124550092 15:30672502-30672524 CACATGATTTGACCCTCAGAAGG + Intronic
1126066581 15:44830524-44830546 CTCCTGCTGTGAGCCTCAGAAGG + Intergenic
1126093301 15:45070345-45070367 CTCCTGCTGTGAGCCTCAGAAGG - Intronic
1126344160 15:47675432-47675454 TTCCTGCTGTGCCCCTCACAGGG - Intronic
1126742992 15:51797107-51797129 TACCTGCTGTCAACCTCAGTGGG - Intronic
1129329712 15:74820798-74820820 AGGATGCTGTGACACTCAGATGG - Intronic
1130849081 15:87776509-87776531 AACCTGCTGTGACCCTGCTGTGG - Intergenic
1132710473 16:1264032-1264054 CACCTGCTGGGAGTCTCAGAGGG + Intergenic
1132733534 16:1374738-1374760 AACCTGCTGTCACCCTGACATGG - Intronic
1133626748 16:7577223-7577245 CTCCTGCTGTGACCCTTAGGTGG + Intronic
1135014349 16:18911659-18911681 TACCAGCTGTGTCCCTCTGAGGG - Intronic
1135352554 16:21741241-21741263 AACCTGCTGTGAGCAGCAGCTGG - Intronic
1135451042 16:22557363-22557385 AACCTGCTGTGAGCAGCAGCTGG - Intergenic
1136331513 16:29580970-29580992 TACCAGCTGTGTCCCTCTGAGGG - Intergenic
1136335678 16:29608862-29608884 AAGCGGCTGGGACCCTCAGCTGG - Intergenic
1136446153 16:30320731-30320753 TACCAGCTGTGTCCCTCTGAGGG - Intergenic
1139012618 16:62650855-62650877 AACATACTGTGACCATTAGATGG + Intergenic
1141535610 16:84677747-84677769 ACCCTGCTGGGACCAACAGAGGG + Intergenic
1141913299 16:87075726-87075748 GACAAGCTCTGACCCTCAGAGGG + Intergenic
1142036399 16:87864663-87864685 AAGCGGCTGGGACCCTCAGCTGG - Intronic
1144847441 17:18227239-18227261 AACCTGCTAGGAACCTGAGAGGG + Intronic
1147497279 17:40928634-40928656 AACCGGCTTTGACAATCAGAAGG + Intronic
1151212229 17:72553122-72553144 CACCTGCTGTGACCCCCACCAGG - Intergenic
1152575217 17:81136908-81136930 CAGCCGCTCTGACCCTCAGATGG - Intronic
1155513094 18:26597021-26597043 AAGCTGCAGTGACCCAGAGAAGG + Intronic
1159743681 18:72205931-72205953 ACCCAGCTGGGACCCTAAGAGGG - Intergenic
1159846068 18:73461495-73461517 AAGCTGCTCAGACCCTCAGCTGG - Intergenic
1160364321 18:78311571-78311593 AGCCCAGTGTGACCCTCAGAGGG + Intergenic
1161327802 19:3671816-3671838 AGCCTGCCGTGACCCCCATAGGG + Intronic
1163505589 19:17704116-17704138 GACCCTCTGTGACCCTCTGACGG + Intergenic
1166262397 19:41649697-41649719 CACCTGCTCTTGCCCTCAGATGG - Intronic
1167278469 19:48552760-48552782 ATGCTGCTGAGACCCCCAGAGGG + Intronic
925297938 2:2790571-2790593 ATCCTGCTGTGAACCTCAGATGG - Intergenic
927198297 2:20563200-20563222 CACCTGCTCTGAACCCCAGAAGG + Intronic
931454624 2:62398834-62398856 AACCTGCTGTTACTGTAAGATGG - Intergenic
935796344 2:106644905-106644927 AATTTGCTGTGACCCTCTGTGGG + Intergenic
936616106 2:114049322-114049344 AACTTGCTGAGACCCGGAGAGGG + Intergenic
937127336 2:119482884-119482906 ATCCTGCTGCAACCCTGAGACGG - Intronic
937826024 2:126369293-126369315 AACCTTCTCAGACCCTCACAGGG - Intergenic
937988273 2:127648396-127648418 CAGCTGCTGTGGCCCTCACATGG - Intronic
937990916 2:127661856-127661878 AATCCTCTGTGACCCTCAGCTGG - Intronic
938979686 2:136514348-136514370 CACCAGTGGTGACCCTCAGAAGG - Intergenic
942710486 2:178829428-178829450 AACCTGCACTGATGCTCAGATGG + Intronic
947777059 2:232721455-232721477 AACCTACTGCTAACCTCAGAGGG - Intronic
1170834555 20:19872525-19872547 AACTTGATGGCACCCTCAGACGG - Intergenic
1171002957 20:21433375-21433397 AACCTGGTGCAACCCTCAGAAGG - Intergenic
1171138759 20:22722883-22722905 ACCCTGCTGTCAGCCTCAAAAGG - Intergenic
1171245136 20:23604637-23604659 AGCCTGATGCAACCCTCAGAGGG - Intronic
1171334111 20:24368109-24368131 AACCTGCTGGGATCCCCAGAAGG + Intergenic
1172150984 20:32790206-32790228 TGCCTGCTGTGACCAGCAGAGGG + Intronic
1172608237 20:36230114-36230136 CATCTGCAGTGGCCCTCAGAAGG - Exonic
1173192173 20:40885064-40885086 AACTTGCTGAGAACCTCAAAAGG - Intergenic
1174008335 20:47428282-47428304 TACCTGCTGTGTCCTGCAGAGGG - Intergenic
1174240892 20:49133727-49133749 AACCTGCTCTTACCCACTGAGGG + Intronic
1175166552 20:57048371-57048393 ACCTTGCTGTCACCCTGAGAGGG + Intergenic
1175835694 20:61992988-61993010 AACAGGTTGTCACCCTCAGAGGG - Intronic
1177502318 21:21973119-21973141 GTCCTGCTGTGAGCATCAGAAGG - Intergenic
1178566630 21:33692405-33692427 AACCTGCTGTGAGAATCAGTGGG + Intronic
1179211626 21:39329798-39329820 AAACTGCCATCACCCTCAGAAGG - Intergenic
1179361000 21:40708641-40708663 TCCCTCCTGTGACTCTCAGATGG - Exonic
1179765977 21:43573521-43573543 ACCCTGCTGTAATCTTCAGAAGG + Intronic
1180079305 21:45479662-45479684 AACCTGCTGTGACCTCCCGAGGG + Intronic
1180968839 22:19804327-19804349 GACCTGCTGTGTCCCTCTGGGGG - Intronic
1181732637 22:24858754-24858776 AACCTGCTGTGCCCATAGGAAGG - Intronic
1181980003 22:26759623-26759645 CACCTGCTCTGCCCCTCAGTGGG + Intergenic
1182499593 22:30736530-30736552 TATCAGCTGTGACCCTGAGAAGG + Intronic
954590127 3:51776016-51776038 AGCCTGCTGAGGCCCTAAGAAGG - Intergenic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
958471204 3:94523157-94523179 AGTCTGCTGTGACCCACAAAGGG + Intergenic
959588263 3:108046836-108046858 AAGCTGCTGTGAACCTGAGTTGG + Intronic
960702049 3:120449008-120449030 CCCCTGCTGTGGCCCTCAAAAGG - Intronic
961559126 3:127716828-127716850 TACCTGCTGTGTCCCCCACATGG - Intronic
961816558 3:129553644-129553666 AGCCTCCTATGACCCTCAAAGGG + Intergenic
964225724 3:154399088-154399110 AACCTGCTGGGATCCTCATTTGG + Intronic
969617678 4:8262947-8262969 ATCCCGCTGTGACCCTGAGCAGG + Intergenic
970545204 4:17122330-17122352 ACCCTCCAGTGCCCCTCAGATGG + Intergenic
976848004 4:89512104-89512126 AAGCTGCTCGGACCCTCAGCTGG + Intergenic
978712285 4:111798893-111798915 CAACTGCTCTGTCCCTCAGAAGG + Intergenic
981692189 4:147522129-147522151 AACATGCTTTTTCCCTCAGATGG - Intronic
983413923 4:167431800-167431822 GATCTGCTGTAACCCTCAGTCGG - Intergenic
991971764 5:72148337-72148359 GACCAGCTGAGACCCACAGAAGG + Intronic
997580226 5:135012378-135012400 ACCCTGCTGGGGCCTTCAGATGG - Intergenic
998806735 5:145924480-145924502 AACCTGATGTTACTCTGAGAAGG + Intergenic
999113278 5:149140778-149140800 TACCTGCTGTTCTCCTCAGACGG + Intergenic
1002688668 5:181035672-181035694 AACCTGCTGTCCCCGGCAGACGG - Intergenic
1003486200 6:6581688-6581710 AAGCTTCTGTCTCCCTCAGATGG - Intergenic
1003972239 6:11310784-11310806 ACCCTGCTGTTAACCTCAGTAGG + Intronic
1004480883 6:16018305-16018327 CACCTTCTGTGGCTCTCAGAAGG + Intergenic
1005347977 6:24909236-24909258 AAGCTGCTGTTACCCTAAGTTGG + Intronic
1006246311 6:32739977-32739999 AACATGCTGAGAATCTCAGAAGG + Intergenic
1010798859 6:80150126-80150148 ATGCTGCTCTGTCCCTCAGAAGG + Intronic
1014228610 6:118876571-118876593 AAACTGTTGTGACCCTGAGTTGG + Intronic
1017383092 6:153852659-153852681 AGCCTGCTGTTACCTTCACATGG - Intergenic
1017873148 6:158502995-158503017 AAGCTGCTGTCACCCTGAAACGG + Exonic
1018706595 6:166467980-166468002 AACATGCTGTGACCCCCTGAGGG + Intronic
1019048457 6:169165823-169165845 CACCCGCTGTGGCCCTCAAAGGG + Intergenic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1030861546 7:114637748-114637770 AAAATGGGGTGACCCTCAGAAGG + Intronic
1033154694 7:138946902-138946924 AAGCTGCAGTGAGTCTCAGAGGG - Intronic
1033756397 7:144400872-144400894 AACTATCTCTGACCCTCAGAGGG - Intronic
1034040529 7:147872489-147872511 ATCTTGCTGCCACCCTCAGAAGG - Intronic
1034086235 7:148325322-148325344 ATCCTTGTGTGACCTTCAGATGG + Intronic
1037767057 8:21778527-21778549 CACCTACTGTGTGCCTCAGAAGG - Intronic
1037767332 8:21780281-21780303 CACCTGCTGTGTGCCTCAGAGGG - Intronic
1038071615 8:24020897-24020919 AACCAGATGTGACCCTTAGGAGG + Intergenic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1039229327 8:35425714-35425736 ACCCTGCTCTGCCCTTCAGAGGG + Intronic
1039406661 8:37318766-37318788 CACCTGCTGAGACCCTGAGGTGG - Intergenic
1039752931 8:40494780-40494802 ATCCTGATATGACCCTGAGATGG - Intergenic
1040459008 8:47629037-47629059 CAGCTGCTGTGACCCTTAAAGGG - Intronic
1044802409 8:95970906-95970928 AACCTGAGGCGACCCTCAAAGGG + Intergenic
1048958298 8:139554951-139554973 AACTTGCAGTGACCCCCTGAGGG - Intergenic
1049922130 9:374955-374977 GAACAGCTGTGACCTTCAGATGG - Intronic
1057262155 9:93591032-93591054 AGACTGCTGTGACCCTCCGAGGG + Intronic
1058953120 9:109921989-109922011 GACATACTGTGCCCCTCAGATGG - Intronic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1060473397 9:123967359-123967381 AACCTTCTGTGATCCCCTGAAGG - Intergenic
1060988937 9:127837333-127837355 AAAATGCTGGGACCCCCAGAAGG - Intronic
1187060907 X:15786410-15786432 AATCTGCTGTGCCCCTTTGAGGG - Exonic
1192170161 X:68849395-68849417 AGGCTGCTGTGACCCTTACAAGG + Intergenic
1199332939 X:146582765-146582787 AGCCTGCTGCTTCCCTCAGAGGG + Intergenic
1200043847 X:153389093-153389115 AGCCTGCTGTGCCCCCCAGTTGG + Intergenic