ID: 1025974536

View in Genome Browser
Species Human (GRCh38)
Location 7:66359300-66359322
Sequence CTAAGGTTCTTTAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 3, 1: 2, 2: 0, 3: 17, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974536_1025974543 6 Left 1025974536 7:66359300-66359322 CCTGGACACTTAAAGAACCTTAG 0: 3
1: 2
2: 0
3: 17
4: 112
Right 1025974543 7:66359329-66359351 TTTCTTCACATGAGGAATCAGGG 0: 1
1: 1
2: 1
3: 29
4: 291
1025974536_1025974539 -2 Left 1025974536 7:66359300-66359322 CCTGGACACTTAAAGAACCTTAG 0: 3
1: 2
2: 0
3: 17
4: 112
Right 1025974539 7:66359321-66359343 AGGACCCATTTCTTCACATGAGG No data
1025974536_1025974544 19 Left 1025974536 7:66359300-66359322 CCTGGACACTTAAAGAACCTTAG 0: 3
1: 2
2: 0
3: 17
4: 112
Right 1025974544 7:66359342-66359364 GGAATCAGGGTGCTGCCCCCTGG No data
1025974536_1025974542 5 Left 1025974536 7:66359300-66359322 CCTGGACACTTAAAGAACCTTAG 0: 3
1: 2
2: 0
3: 17
4: 112
Right 1025974542 7:66359328-66359350 ATTTCTTCACATGAGGAATCAGG 0: 1
1: 0
2: 2
3: 34
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974536 Original CRISPR CTAAGGTTCTTTAAGTGTCC AGG (reversed) Intronic
901861248 1:12076007-12076029 CTAAGGGTATTTAAGGGTTCTGG - Intronic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
910106754 1:83639557-83639579 CCTAGGTTCTTTAAGTGACATGG - Intergenic
912146772 1:106803787-106803809 TTAAGGTAGTTTAAGAGTCCGGG + Intergenic
912745658 1:112243497-112243519 CCAAGGTTCTTTCAGTGAACCGG + Intergenic
913471430 1:119191223-119191245 CACAGGTTCTTTAATTGTACAGG - Intergenic
914386823 1:147177825-147177847 CTAATGTTCTTTTTCTGTCCTGG - Intronic
918658065 1:187053834-187053856 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
919020643 1:192100992-192101014 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
921278994 1:213546931-213546953 CTAATGTTCTGTTACTGTCCAGG + Intergenic
1067196481 10:44123874-44123896 CTAATGTCCTTTATGTGTTCAGG + Intergenic
1067210451 10:44256519-44256541 CTGGGGTTCTTTAATTTTCCAGG + Intergenic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1068366163 10:56052832-56052854 CTAAGATTATTTAAGGGTTCAGG + Intergenic
1073734488 10:106330286-106330308 CAAAGCTTCTTTAAGTGGTCAGG - Intergenic
1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG + Intergenic
1075829340 10:125392206-125392228 TTATGGTTCTTTGAGTGGCCAGG + Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1081548371 11:44089161-44089183 CTAAGATTATTTAAGGGTTCAGG - Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088141959 11:106628170-106628192 CTAAGAGTATTTAAGTGTTCAGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1089909929 11:122087700-122087722 CTAATTGTCTTTATGTGTCCAGG + Intergenic
1091257847 11:134206436-134206458 CTAATGTGCTTTATGTGTCTGGG - Intronic
1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG + Intronic
1095412524 12:41939424-41939446 CTGAAGTTATGTAAGTGTCCAGG - Intergenic
1095523808 12:43100900-43100922 TTAAGGTTCTGTAAGTGTTCAGG - Intergenic
1097699482 12:62805424-62805446 CTAAGGTTGTTTCAGTGTCTTGG - Intronic
1100344351 12:93712608-93712630 CCTGGGTTCTTTCAGTGTCCTGG - Intronic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1103132354 12:118480325-118480347 CTAAGGGTATTTAAGGGTTCAGG + Intergenic
1103157219 12:118696230-118696252 ATAAGGCTATTTTAGTGTCCAGG - Intergenic
1111362591 13:87194665-87194687 CTCAGGTGATTTAAGTGACCTGG - Intergenic
1111705818 13:91748422-91748444 TTAAAGTTCTTTAAGTGCACAGG - Intronic
1112589703 13:100751755-100751777 TTGGGGTTCCTTAAGTGTCCAGG - Intergenic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG + Intergenic
1119247071 14:73119558-73119580 TTAAGGTTGTTTTAGTGGCCGGG - Intronic
1119375694 14:74190685-74190707 CTAAAGTTCTTTAGGTGGCCAGG - Intronic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1122767931 14:104084665-104084687 CTAAGGATCTTTAAGGGTTTAGG + Intergenic
1127510506 15:59636209-59636231 CTAAGATTCTTTAAGTTCCAGGG + Intronic
1128334048 15:66774675-66774697 CCACCGTTCTTTAAGTATCCAGG + Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1149800011 17:59558380-59558402 CTAAGATTATTTAAGAGTTCAGG - Intergenic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1160432929 18:78824696-78824718 CAAAGGTGCTTTAAGGGTGCGGG + Intergenic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
926791725 2:16578908-16578930 TTATGGTTCTCTAAGTTTCCTGG - Intronic
927669483 2:25057108-25057130 CTCAGGTTCTTTATGTAACCTGG + Intronic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
930693419 2:54387333-54387355 CTGAGGTTTTTTAAGTTTCAGGG - Intergenic
931859285 2:66337044-66337066 CTATGCTCCTTTAAATGTCCAGG + Intergenic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
940424491 2:153515003-153515025 CTAAGGGTTTTTAAGTGTTTTGG + Intergenic
941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG + Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
944109517 2:196117209-196117231 GTAATGTTCTTTAAGGGTACTGG + Intergenic
1170401945 20:15995921-15995943 CTTAGGTTGTTTCTGTGTCCTGG + Intronic
1173418556 20:42880257-42880279 CTAGGGTTCTATGAGTTTCCTGG - Intronic
1176884898 21:14243911-14243933 CTGAGTTTCTTTTAGTGTGCTGG - Intergenic
1179200517 21:39215293-39215315 CTCAGGTTCGTTAAATGTTCTGG + Exonic
949362819 3:3249744-3249766 CCAGGGTTCTTTCAGTCTCCCGG - Intergenic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
951962456 3:28343676-28343698 CTAAGCTTCTTTACCTTTCCAGG - Intronic
953643040 3:44727567-44727589 CTAAGGTTATTTTAGTGTTTTGG + Intergenic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
959349723 3:105246851-105246873 CTATGATTCTTTAGGTTTCCTGG + Intergenic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
962263541 3:133929577-133929599 CAAAGCTGGTTTAAGTGTCCCGG + Exonic
962962034 3:140320174-140320196 CTTAGGTTCTTTAGGTCTCACGG - Intronic
963575778 3:147059396-147059418 CCCAGGTTCCTTAAGTGTACTGG - Intergenic
966663091 3:182436980-182437002 CTAAGGTTGTTTAAATGTTTAGG + Intergenic
967348225 3:188482533-188482555 CTTAGGTTTTATAGGTGTCCTGG + Intronic
970098966 4:12498538-12498560 TTAAGGTACTTTTAGTGTACTGG + Intergenic
970425526 4:15942367-15942389 CTAATGTTCTTTTTCTGTCCAGG + Intergenic
973951762 4:56022608-56022630 CTCAAGTTCTTTAAGAGTCTAGG + Intronic
976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG + Intergenic
988144496 5:27288298-27288320 CTAAGATTCTTTATGTTTCAAGG - Intergenic
989470568 5:41812841-41812863 TTCAGGCTCTTTAAGGGTCCTGG - Intronic
989996543 5:50839815-50839837 CTAATGCTTTTTAAGTGTCAGGG + Intronic
990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG + Intronic
992503059 5:77360360-77360382 CTAAGGTACTGTAAGTCTCTTGG - Intronic
995645023 5:114301857-114301879 CTGAGGTTTGTTAAGTGACCAGG + Intergenic
999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG + Intergenic
1004391910 6:15217078-15217100 CAAAGGTTGTATGAGTGTCCAGG - Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1010687936 6:78873795-78873817 CAAAGGTTCCTTAAGAGACCAGG - Intronic
1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG + Intronic
1017505081 6:155060947-155060969 CTTGTGTTCTTTTAGTGTCCTGG + Intronic
1021572566 7:22081367-22081389 TGAAGCTTCTTTAAGTGTCTGGG - Intergenic
1021620719 7:22549279-22549301 CAAAGGCTCTTTAAGTGTGGTGG - Intronic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1022579770 7:31539729-31539751 CTAAGGTTATTTAAGGGTTCAGG + Intronic
1024012613 7:45282837-45282859 TTAATGTTCTTTTATTGTCCAGG + Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1035568417 8:657277-657299 CTAAGGGTATTTAAGAGTTCCGG + Intronic
1035770247 8:2141550-2141572 CTAAGGGTATTTAAGGGTTCTGG + Intronic
1036531166 8:9588827-9588849 CTATGGTTCTTTTAGTGACCAGG + Intronic
1037426472 8:18761018-18761040 CAAAGGTTCTTCAAGATTCCAGG + Intronic
1040359515 8:46651859-46651881 CTCAGGGTCTGTAAGTGGCCTGG + Intergenic
1040908984 8:52499123-52499145 CTAAGATATTTTAAGTTTCCTGG + Intergenic
1040909111 8:52500743-52500765 CTAAGATGTTTTAAGTTTCCTGG + Intergenic
1042631819 8:70825765-70825787 CAAAGGATTTTTAAGTATCCAGG - Intergenic
1043947427 8:86269984-86270006 CCAATGTTCTGTGAGTGTCCTGG - Intronic
1044367106 8:91360678-91360700 CTATGGTTTTTTAAGTGGCAGGG + Intronic
1045588894 8:103570566-103570588 CTAAGGTACTCTCAGTGTGCTGG - Intronic
1047924973 8:129673968-129673990 CTCAGCTTCTGTAAGTTTCCAGG + Intergenic
1048621355 8:136136241-136136263 CTAAGGGTCTTTATGATTCCAGG + Intergenic
1052743633 9:32417780-32417802 CAAGAGTTCTTTAAATGTCCAGG + Intronic
1052962391 9:34310297-34310319 CAAAGCATCTTTAAGTCTCCTGG + Intronic
1055423588 9:76169819-76169841 CTAAGGAACTTTAAGACTCCAGG + Exonic
1058360879 9:104144584-104144606 CTCAGGTTCTGTTAGTGTACTGG - Intergenic
1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG + Intergenic
1189664800 X:43342636-43342658 ATAAGGTTATATAAGTGTCTGGG + Intergenic
1194872839 X:99154064-99154086 GTAAGATTCTTTAATTATCCTGG - Intergenic
1196468774 X:116000986-116001008 CTAAGATACTTTAGTTGTCCAGG + Intergenic
1197034976 X:121862426-121862448 CTAAAGTTTTTTAATTGTCCAGG - Intergenic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic
1199929970 X:152507983-152508005 ATAAAGTTCTTTTAGTGTTCTGG + Intergenic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic