ID: 1025974561

View in Genome Browser
Species Human (GRCh38)
Location 7:66359423-66359445
Sequence CTAAGGTTCTTCAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 4, 2: 1, 3: 7, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974561_1025974565 1 Left 1025974561 7:66359423-66359445 CCTGGACACTTGAAGAACCTTAG 0: 1
1: 4
2: 1
3: 7
4: 95
Right 1025974565 7:66359447-66359469 ACCCATTTCTTCACATAAGGAGG 0: 1
1: 4
2: 4
3: 8
4: 114
1025974561_1025974570 22 Left 1025974561 7:66359423-66359445 CCTGGACACTTGAAGAACCTTAG 0: 1
1: 4
2: 1
3: 7
4: 95
Right 1025974570 7:66359468-66359490 GGAATCAGGGTCTTGACCCCTGG No data
1025974561_1025974568 8 Left 1025974561 7:66359423-66359445 CCTGGACACTTGAAGAACCTTAG 0: 1
1: 4
2: 1
3: 7
4: 95
Right 1025974568 7:66359454-66359476 TCTTCACATAAGGAGGAATCAGG 0: 1
1: 4
2: 2
3: 9
4: 150
1025974561_1025974569 9 Left 1025974561 7:66359423-66359445 CCTGGACACTTGAAGAACCTTAG 0: 1
1: 4
2: 1
3: 7
4: 95
Right 1025974569 7:66359455-66359477 CTTCACATAAGGAGGAATCAGGG 0: 1
1: 4
2: 1
3: 17
4: 186
1025974561_1025974564 -2 Left 1025974561 7:66359423-66359445 CCTGGACACTTGAAGAACCTTAG 0: 1
1: 4
2: 1
3: 7
4: 95
Right 1025974564 7:66359444-66359466 AGGACCCATTTCTTCACATAAGG 0: 1
1: 5
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974561 Original CRISPR CTAAGGTTCTTCAAGTGTCC AGG (reversed) Intronic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
906489666 1:46258550-46258572 GTAAGGTTCTACAAATATCCAGG - Intronic
917492423 1:175508761-175508783 CTAAGCTTCTTCCAGATTCCTGG + Intronic
919507247 1:198414732-198414754 TTAAGGTTCTTCAAATTTCAAGG + Intergenic
921301617 1:213756308-213756330 CTAAGGCTTTTCCAGTCTCCCGG - Intergenic
921521102 1:216155132-216155154 CTAAATTTCTCCCAGTGTCCAGG - Intronic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1070402076 10:76061770-76061792 CCATGATTCTTCAAGTGCCCAGG + Intronic
1070940204 10:80337773-80337795 CTGAGGTTCCTCAACTGTGCTGG + Intronic
1071913869 10:90268207-90268229 CTAAGCTTCTCCCAGTTTCCTGG - Intergenic
1073644765 10:105289886-105289908 GTAAGGTTGTTCAAGTCTTCTGG - Intergenic
1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG + Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1076922667 10:133463009-133463031 CCAATGTTCTCCAAGTATCCTGG + Intergenic
1079881552 11:25933935-25933957 TTAAGGTCCATCAAGTTTCCTGG + Intergenic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1087972247 11:104498848-104498870 CTATAGTTCTTCAAGTTACCTGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG + Intronic
1095523808 12:43100900-43100922 TTAAGGTTCTGTAAGTGTTCAGG - Intergenic
1097699482 12:62805424-62805446 CTAAGGTTGTTTCAGTGTCTTGG - Intronic
1098477304 12:70920469-70920491 CCAAGGGTCTTCTAGTCTCCGGG + Exonic
1099052131 12:77792923-77792945 CTATGGCCCTTCAAGTGTGCTGG + Intergenic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1107026481 13:35806885-35806907 CTCATTTTCTTCAACTGTCCAGG - Intronic
1108059562 13:46519126-46519148 CCAAGGCTCTACAAGTCTCCAGG + Intergenic
1108957641 13:56181370-56181392 TTAAGGTTCTTCAGGTTTTCAGG + Intergenic
1114615231 14:24064712-24064734 CTCAGCTTCTCCAAGTGACCTGG - Intronic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1114707316 14:24740357-24740379 CCAAGGTTCTTCAAGATTCAAGG + Intergenic
1115955719 14:38777096-38777118 CTGAGGTGGTTCCAGTGTCCTGG - Intergenic
1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG + Intergenic
1119375694 14:74190685-74190707 CTAAAGTTCTTTAGGTGGCCAGG - Intronic
1120037146 14:79710742-79710764 CTGATGTTGTTCAAGTGCCCAGG - Intronic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1122790827 14:104183509-104183531 CTCAGTTTCCCCAAGTGTCCCGG - Intergenic
1123961101 15:25402135-25402157 CTCAGCTTCTTCAAATGTGCAGG - Intronic
1126497564 15:49309045-49309067 CTAGGCTTCTTCTGGTGTCCGGG + Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1158007067 18:52684775-52684797 TAAAGGATCTTCAAGTGTACAGG + Intronic
1162996229 19:14337457-14337479 GAAGGGTTCTTCAAGTGTTCTGG - Intergenic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
926997350 2:18750790-18750812 CTAAGTTGCTTCAATTGTCTGGG + Intergenic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
929561291 2:42958053-42958075 CTCAGGTCCTTCAGGGGTCCTGG + Intergenic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
930691077 2:54365288-54365310 ACAGGGTTCTTCAAGTTTCCTGG - Intronic
933272148 2:80244512-80244534 CTAAGTTACTTCACGTGCCCAGG - Intronic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG + Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
946411981 2:219520060-219520082 CTCAGGGTCCTCAAGGGTCCAGG + Intronic
1175313326 20:58026847-58026869 CTAAGGCTCTTCAAATGTGATGG - Intergenic
1181616982 22:24061577-24061599 CTCAGCTTCCTCAAGTGCCCTGG + Intronic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
950520650 3:13495908-13495930 ATAAGTGTCTGCAAGTGTCCTGG + Intronic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
954378475 3:50206943-50206965 CTCAGTTTCTCCAACTGTCCAGG - Intronic
958713105 3:97741982-97742004 GTAATGTTCTTCAAGTGGCTGGG - Intronic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
967681598 3:192370148-192370170 TTAAAGATCCTCAAGTGTCCTGG - Intronic
974881670 4:67766159-67766181 CTATGATTCTCCAAGAGTCCCGG + Intergenic
976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG + Intergenic
977698041 4:99989063-99989085 CTAAATTTCTTCATGAGTCCTGG + Intergenic
985717459 5:1470578-1470600 CTGAGGTTCTTCCTGGGTCCTGG - Intronic
987906303 5:24082016-24082038 CAGAGGCTTTTCAAGTGTCCTGG + Intronic
990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG + Intronic
994148329 5:96420029-96420051 CTAAGTCTCCTCAAGTGTCTGGG + Intronic
999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG + Intergenic
1000518341 5:162268573-162268595 CTAAGTTTCTTCAAATATCTAGG + Intergenic
1001777710 5:174341394-174341416 ATAAGCTTCTTCATGTGTCAGGG - Intergenic
1006013437 6:31061672-31061694 CTCAGGTTCTCCAAGTGTAAGGG - Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1013954420 6:115824232-115824254 CTAAGTTTCTTCAACTGTAAAGG + Intergenic
1015480682 6:133704795-133704817 CTAAAGTTTTTCAAAAGTCCTGG + Intergenic
1021094947 7:16525912-16525934 TTAAGGCTCCTCAAGAGTCCAGG - Intronic
1021239435 7:18182152-18182174 CTCAAGCTCTTCAAGTTTCCAGG - Intronic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1022579770 7:31539729-31539751 CTAAGGTTATTTAAGGGTTCAGG + Intronic
1024913181 7:54469456-54469478 ATAAGCATCCTCAAGTGTCCTGG + Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1034283730 7:149870975-149870997 CCTAGGGCCTTCAAGTGTCCTGG + Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1035855891 8:2975886-2975908 CTGATGTTCCTCAAGTCTCCAGG - Intronic
1036531166 8:9588827-9588849 CTATGGTTCTTTTAGTGACCAGG + Intronic
1037426472 8:18761018-18761040 CAAAGGTTCTTCAAGATTCCAGG + Intronic
1043671817 8:82895940-82895962 TTACTGTTCTTCAAGTCTCCTGG + Intergenic
1047324550 8:123824092-123824114 CTGATGTTCTCCAAGTTTCCAGG - Intergenic
1057514927 9:95712895-95712917 CTAGGGATCGTCAAGTGTGCAGG + Intergenic
1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG + Intergenic
1059693854 9:116712245-116712267 CTTACCTTCTTCAAGTGTTCTGG + Intronic
1185950565 X:4428029-4428051 CTAAGTTTTTGCTAGTGTCCTGG + Intergenic
1195685065 X:107577968-107577990 CTGAGTTGCTTCAAGTCTCCAGG + Intronic
1197034976 X:121862426-121862448 CTAAAGTTTTTTAATTGTCCAGG - Intergenic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic