ID: 1025974573

View in Genome Browser
Species Human (GRCh38)
Location 7:66359486-66359508
Sequence CTAAGGTTCTTAAAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 4, 2: 0, 3: 8, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025974573_1025974579 6 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974579 7:66359515-66359537 TTTCTTCACACGAGGAATCATGG No data
1025974573_1025974576 -2 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974576 7:66359507-66359529 AGGACCCATTTCTTCACACGAGG 0: 1
1: 5
2: 2
3: 5
4: 74
1025974573_1025974580 19 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974580 7:66359528-66359550 GGAATCATGGTGCTGACCCCTGG 0: 1
1: 2
2: 5
3: 18
4: 146
1025974573_1025974581 27 Left 1025974573 7:66359486-66359508 CCTGGACACTTTAAGAACCTTAG 0: 1
1: 4
2: 0
3: 8
4: 110
Right 1025974581 7:66359536-66359558 GGTGCTGACCCCTGGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025974573 Original CRISPR CTAAGGTTCTTAAAGTGTCC AGG (reversed) Intronic
900534227 1:3169130-3169152 CTGAGGCTCAGAAAGTGTCCAGG - Intronic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
902464568 1:16608070-16608092 CTAAGGCTCCTACACTGTCCTGG - Intronic
903156239 1:21445635-21445657 CTAAGGCTCCTACACTGTCCTGG + Intronic
904838657 1:33356011-33356033 TTTAGGTTCTTAAAGTATCCAGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
910125502 1:83837634-83837656 CTAAGATCCCTAAAATGTCCAGG + Intergenic
1062773945 10:129742-129764 ATAAGTCTCTTAAAGAGTCCTGG + Intergenic
1067394040 10:45895465-45895487 CTACACTTCTTTAAGTGTCCTGG + Intergenic
1067862364 10:49864598-49864620 CTACACTTCTTTAAGTGTCCTGG + Intronic
1073423339 10:103441504-103441526 CTCAGCTTCTTAAAGTGTTGGGG + Intronic
1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG + Intergenic
1076246303 10:128950142-128950164 CTAAGGAGCTTGGAGTGTCCAGG - Intergenic
1078480394 11:11670640-11670662 CTGGAGATCTTAAAGTGTCCTGG - Intergenic
1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG + Intronic
1080325427 11:31066525-31066547 CTAAGGTACTTACATTGTTCTGG + Intronic
1080594724 11:33761043-33761065 CTAAAGTTCTTTCATTGTCCAGG + Intronic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1087602807 11:100338231-100338253 TTAAGGTTCTTAATATGTCGTGG + Intronic
1087878263 11:103384663-103384685 CTAAGCTTCTTGAACTGTCTGGG - Intronic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1090101529 11:123802431-123802453 CTAAAGTTATAAAAGTGTGCAGG + Intergenic
1092152852 12:6263004-6263026 CTAAGGTGCTTAAGTTGTCTGGG - Intergenic
1094330968 12:29292868-29292890 ATAAGGTTGATAAAGTGTCCTGG + Intronic
1095232338 12:39754400-39754422 CTAAGGTTCTTAACGTCAGCAGG - Intronic
1095523808 12:43100900-43100922 TTAAGGTTCTGTAAGTGTTCAGG - Intergenic
1097699482 12:62805424-62805446 CTAAGGTTGTTTCAGTGTCTTGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098159688 12:67638101-67638123 CAATTGTTCTTAAATTGTCCTGG - Intergenic
1100837953 12:98585037-98585059 CTAAGGCTGATGAAGTGTCCTGG - Intergenic
1101419627 12:104539595-104539617 CCAAGGGTCCTAACGTGTCCTGG - Intronic
1107800665 13:44105217-44105239 GCAAGGTTCTTAAACAGTCCTGG + Intergenic
1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG + Intronic
1110112564 13:71766275-71766297 CTAAGGTACTTAAAGGCTACAGG - Intronic
1113178364 13:107594955-107594977 CTATGGATCTGAAAGTGTACAGG - Intronic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1117039773 14:51759325-51759347 CTAATGTTTTTAAAATGTCTCGG - Intergenic
1118372794 14:65152169-65152191 CTAAGGTTCCTCAAATGCCCAGG + Intergenic
1119375694 14:74190685-74190707 CTAAAGTTCTTTAGGTGGCCAGG - Intronic
1120278267 14:82406395-82406417 CTGAGGTTGGTTAAGTGTCCTGG + Intergenic
1121423793 14:93833894-93833916 GAATGGTTCTGAAAGTGTCCCGG - Intergenic
1125911378 15:43442747-43442769 CTCAGGTTCCCAAAGTGTGCTGG + Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1138105953 16:54287186-54287208 CTAAGCTGCTGAAAGTGGCCGGG - Intergenic
1139766610 16:69235804-69235826 CTAAGTTTCTTCAAATATCCTGG + Intronic
1144829776 17:18124661-18124683 CTGAGGCTCTGAAAATGTCCTGG - Intronic
1153968613 18:10204310-10204332 CTAGGGTTCCTAAAGTCTCTTGG + Intergenic
1155202664 18:23530930-23530952 CTAAGGGTTTTAAAGGGTCTGGG + Intronic
1155473453 18:26214506-26214528 TTAAGGAACTTAAAGTGTTCTGG + Intergenic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1158584118 18:58715267-58715289 CTAAGATTCTAAAATTTTCCTGG + Intronic
1166965486 19:46527273-46527295 CTAAGGTTGATGAAGTGTGCCGG - Intronic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
929734412 2:44531426-44531448 TTAAGGTTCTTTAAATATCCTGG + Intronic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
933101258 2:78261252-78261274 CTAAGATTTTGAATGTGTCCTGG + Intergenic
933432671 2:82204226-82204248 CTAATTTTCTTATAGTGTCTTGG - Intergenic
933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG + Intergenic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
935703495 2:105835635-105835657 TTAAGGATCTTAGAGTTTCCTGG + Intronic
939908996 2:147956525-147956547 CTTAGGTTCTTATAATGTCCAGG + Intronic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
941068185 2:160926913-160926935 CTAATGTTCTTGGAGAGTCCAGG + Intergenic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
947771930 2:232676881-232676903 CTCAGCTTCCCAAAGTGTCCAGG - Intronic
948904781 2:240973622-240973644 CACAGGTTCTAAAAGTTTCCGGG + Intronic
1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG + Intergenic
1183595760 22:38809512-38809534 CTAATGTCCTTACATTGTCCTGG - Intergenic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG + Intronic
951017584 3:17746963-17746985 CGAATGTTCTTAAAGTCTCTTGG + Intronic
953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG + Intronic
953999604 3:47545386-47545408 CTAAGGTTCTTTAATTGCCTGGG + Intergenic
955661389 3:61303138-61303160 CTTATGTTCTCAAAGTGTCAGGG + Intergenic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
960330779 3:116357966-116357988 CCAAGTTTCCTAAAGTTTCCTGG - Intronic
960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG + Intronic
964115259 3:153130172-153130194 TTAAGTTTATTAAAGTGTCTTGG + Intergenic
965542755 3:169886881-169886903 CAGAGATTCCTAAAGTGTCCTGG - Intergenic
967844701 3:194034465-194034487 CAGTGGTTCTTAAAGTGTCTTGG - Intergenic
968018632 3:195363340-195363362 CTAATATTGTTAAAATGTCCAGG + Intronic
969263693 4:6050309-6050331 CTAAGGCTCTGAAAGTTTACAGG + Intronic
970003245 4:11385542-11385564 CTAAGGTTCTCAAATACTCCTGG + Intergenic
976466855 4:85379943-85379965 CTCAAGTTCTTAAAGTGTACAGG + Intergenic
985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG + Intronic
989792169 5:45419063-45419085 CCAAGTTCCTGAAAGTGTCCAGG - Intronic
990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG + Intronic
991923610 5:71682212-71682234 GTAAGGTTCTTAAAGTATTAAGG - Intergenic
998469612 5:142373317-142373339 CTCAGCTTCCCAAAGTGTCCGGG + Intergenic
998808392 5:145940838-145940860 CTAAGGCTCTCAAAGTGTTTTGG - Intronic
999761166 5:154702258-154702280 CTAAGTATCTTCAAGTGGCCAGG + Intergenic
1003146138 6:3512121-3512143 CTAGAGTTCTGAAAGTATCCAGG + Intergenic
1006132060 6:31875675-31875697 CAATGGTTCTTAACGTGGCCTGG + Intronic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1012001569 6:93661572-93661594 CAAAGCTTCTAAGAGTGTCCGGG + Intergenic
1019062537 6:169266485-169266507 CACAGGTTCTAAAAGGGTCCAGG + Intergenic
1020862873 7:13516424-13516446 CTAAGATTCTTATAATCTCCAGG - Intergenic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1022480770 7:30741649-30741671 CTCAGGTTCTTAAAGTGGAAAGG - Intronic
1022579770 7:31539729-31539751 CTAAGGTTATTTAAGGGTTCAGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1030920908 7:115385267-115385289 CAAACGTTCTTAAAGTCTCTTGG + Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1036097879 8:5743835-5743857 CAGAAGTTATTAAAGTGTCCAGG + Intergenic
1036531166 8:9588827-9588849 CTATGGTTCTTTTAGTGACCAGG + Intronic
1037426472 8:18761018-18761040 CAAAGGTTCTTCAAGATTCCAGG + Intronic
1039517450 8:38145731-38145753 TTAAGGTTCTTAAACTTTCTGGG + Intronic
1046909429 8:119609562-119609584 CTAGGGTTCAGAATGTGTCCTGG + Intronic
1048255696 8:132903537-132903559 CTGAGAGTCTTAAAGTGACCAGG + Intronic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1056035437 9:82600200-82600222 TTAAGGTTCTTATTCTGTCCAGG - Intergenic
1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG + Intronic
1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG + Intergenic
1059201288 9:112419506-112419528 AAAAGATTCTTAAAGTGTTCCGG - Intronic
1185839675 X:3376904-3376926 CTAAGGTCCTTAAAATGTTGCGG - Intergenic
1186786635 X:12962158-12962180 CCAAAGTTCTTAAAATGGCCTGG + Intergenic
1197034976 X:121862426-121862448 CTAAAGTTTTTTAATTGTCCAGG - Intergenic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic
1200795509 Y:7337819-7337841 CTAAGGTTGTATAAGTATCCAGG - Intergenic